Labshake search
Citations for Qiagen :
401 - 450 of 3581 citations for 5 Methoxy 1 Triisopropylsilyl 1H Pyrrolo 2 3 B Pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... total RNA was extracted from the B cells using the RNeasy Mini Kit (Cat. #74004, QIAGEN, Germany) as per the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA from 1-5 million total CD4+ T cells was isolated using the Gentra Puregene Cell Kit (Qiagen) or phenol-chloroform and the DNA concentration was measured by Qubit High Sensitivity Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: The LRH-1-10CA-TIF2 complex was concentrated to 5 mg/mL and screened using the Classics screen (Qiagen) and a Phoenix Liquid Handler (Art Robbins Instruments ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was isolated from B cells either using Blood and Tissue or Flexigene kits (Qiagen, Hilden, Germany). DNA was quantified with Qubit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from naïve and cultured B cells using Trizol and RNeasy kit and Dnase treatment (Qiagen) and retro-transcribed to cDNA using random hexamers (Roche ...
-
bioRxiv - Immunology 2020Quote: DAFhi and DAFlo GC B cells (CD19+ CD20+ CD38+ IgD−) were resuspended in RLT cell lysis buffer (Qiagen) after flow cytometric sorting ...
-
bioRxiv - Immunology 2022Quote: Total RNA was extracted from FO and MZ B cells using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Inhibitors (antimiRs) against miR26b-5p and miR200a/b/c-3p were purchased from Qiagen (339130 and 339160 respectively). AntimiRs in injection media (1mM Tris-HCL pH 7.5 and 0.5 mM EDTA in embryo grade water ...
-
bioRxiv - Immunology 2023Quote: ... ∼12,000-15,000 B cells from the tetramer-enriched fraction were sorted directly into Buffer RLT (Qiagen; Hilden, DE) prior to shipment on dry ice to iRepertoire ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5μl of diluted cDNA (1:3 - nuclease-free water) was used as template in 10μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.5-1 μg of total RNA was reverse transcribed into first-strand cDNA using an RT2 First Strand Kit (QIAGEN). The resultant cDNA was subjected to qPCR using human cytokine-specific primer (Realtimeprimers.com ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA was separated on a 1% agarose gel and the ∼5 Kb genomic DNA band was harvested with a QIAquick Gel Extraction Kit (Qiagen). The DNA library was prepared according to the manual of the Ligation Sequencing Kit (Nanopore) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed by boiling (5 min 95°C) followed by bead beating (3mm beads, 30 Hz for 1 min) (TissueLyser II, Qiagen) and sonication bath (3×10 sec at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... several loci were amplified simultaneously from 1 μl of extracted DNA using 5 μl of the Multiplex PCR Master Mix (Qiagen) and varying amounts of the pooled primer mixes (Pool A ...
-
bioRxiv - Microbiology 2021Quote: ... samples were weighed and homogenized in DMEM containing 10% FBS and 1% antibiotics using 5 mm stainless steel beads (Qiagen) and the TissueLyser II (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... and homogenized twice for 1-5 minutes each at 25Hz using a TissueLyser LT sample disruptor (Qiagen, Part No. 85600) with a 12 tube Tissue Lyser LT adapter (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Molecular Biology 2023Quote: cDNA was produced from 1 μg of total RNA (final cDNA concentration 5 ng/ml) using QuantiTech Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Metagenomic sequencing libraries were constructed from extracted DNA samples with 10 μL (1/5 volume) reactions using the QIAseq FX DNA Library Kit (QIAGEN). Each metagenomic sequencing library was sequenced using the Illumina NextSeq 2000 System 2 x 150 bp configuration.
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from input and IP samples by incubation with 1 mL Trizol at room temperature for 5 minutes and then RNeasy Lipid Tissue Mini Kit (Qiagen) via the manufacturer’s protocol with on-column DNase treatment (Roche) ...
-
bioRxiv - Plant Biology 2022Quote: ... using 3-mm steel beads (Cat No.: 69997, Qiagen); tubes were shaken for 20-s at 28 Hz with dry ice.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two sterile 3 mm beads (Qiagen, Hilden, Germany) and a bead device at 20 Hz for 3 min ...
-
bioRxiv - Immunology 2020Quote: ... and prepared the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). 10ng purified RNA was used for the NGS libraries ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in 3 volumes RLT buffer (Qiagen) and RNA was extracted using Dynabeads MyOne Silane (Life technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
bioRxiv - Genomics 2021Quote: ... 3 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template containing cDNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 µl of cell extracts ...