Labshake search
Citations for Qiagen :
401 - 450 of 530 citations for 4 4 Fluorophenyl Ethynyl Phenyl Ethynyl Trimethylsilane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Filters were incubated at 55°C for approximately 4 h and the resulting lysates were purified with the DNeasy kit (Qiagen) using a slightly modified protocol49 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from the hippocampus of P65 females of all four groups (n=4/group) using the RNeasy Midi Kit (Qiagen). RNA samples were submitted to the University of Minnesota Genomics Center for library preparation and sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen). 4-week-old NRG mice were injected intra-hepatically using 10 µg of RNA in a maximum volume of 50 µL of PBS+RNA and one week post injection a terminal bleed was performed ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1.5 h in 50 mL conical tubes ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Sample DNA was extracted from microbiome samples using the PowerSoil DNA extraction kit (Cat. No. 12955-4, Qiagen, Valencia, California). Marker genes in isolated DNA were polymerase chain reaction (PCR)-amplified using GoTaq Master Mix (Cat ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were selected in puromycin (1 μg/ml) the next day and after 4 days genomic DNA was extracted using DNeasy Blood and Tissue kit (Qiagen). Genomic DNA was sonicated to an average size of 500 bp using S2 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplicons were size-verified on a 4% agarose gel and PCR amplicons were extracted and purified (Qiaquick Gel Extraction Kit, Qiagen) before indexing (Nextera XT ...
-
bioRxiv - Pathology 2023Quote: ... tissue and cells were lysed in RIPA lysis buffer supplemented with orthovanadate and a cocktail of protease inhibitors at 4°C (using a TissueLyser (Qiagen) to homogenize liver tissue ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1 h in 50 mL conical tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were centrifuged for 30 min at 38,000 g and 4°C and cleared supernatants loaded onto Ni-NTA columns with 0.5 mL bed volume (1018244 Qiagen, Germany). The columns were washed sequentially with 3 column volumes (CV ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysates were centrifuged at 10000 g for 30 min at 4 °C and the clear supernatant was collected and passed through Ni-NTA agarose column (Qiagen). Contaminating proteins were washed away by passing a 20–120 mM imidazole gradient through the column while the bound toxins were eluted using PBS containing 500 mM imidazole ...
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated from ciDKO podocytes (3 days after Cre lentiviral transduction) and wild-type control cells (n=4 for each group) using an RNeasy mini kit (Qiagen). RNA was quantified using a Qubit Fluorimeter (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... and then spun down 4 ml of the culture before proceeding to isolation of the final plasmid using a QIAprep Spin Miniprep kit (Qiagen). The samples were stored at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: DNA extraction was carried out from 300 μL culture pellets using the DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4). Subsequent library preparation and sequencing were conducted at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... were immediately placed in RNAlater during dissection and stored at 4 degrees Celsius until RNA isolation using the RNeasy Mini Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Culture supernatant containing His-tagged NTD protein was harvested 4 days after transfection and was purified using Ni-NTA resin (Qiagen). Spike protein was further purified with a Superose 6 Increase 10/300 GL column equilibrated with 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was eluted in 100 µL of TE-0.5% SDS buffer with Proteinase K at 60 °C for 4 hours and purified using the MiniElute PCR purification kit (Qiagen).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Digoxigenin (DIG)-labelled probes were denatured at 90°C for 4 min and diluted with 1 x microRNA ISH buffer (Qiagen), following protocol by Endisha & Kapoor ...
-
bioRxiv - Genomics 2024Quote: ... The pooled cells were centrifuged at 500 × g for 5 minutes at 4°C and resuspended in 100 μl of buffer EB (Qiagen).
-
bioRxiv - Immunology 2024Quote: Bladders were weighed and homogenized in 1 mL of sterile PBS at 4°C using a handheld rotor-stator tissue homogenizer (TissueRuptor II, Qiagen). Homogenates were serially diluted ...
-
bioRxiv - Genomics 2024Quote: Ten aphids (n = 10 × 4) were ground to powder with a liquid nitrogen-cooled micropestle after which the RNeasy kit (Qiagen) was used for RNA extraction with on-column DNA digestion (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from 5,000 sorted melanocytes from 3-4 control or ID1-overexpressing fish per stage using RNeasy Micro Kit (Qiagen, 74004). Ultralow input RNA-seq was performed using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Clontech ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was then cleared by centrifugation at 42,000 ξ g for 50 min at 4°C before being applied to 2 mL of Ni-NTA resin (QIAGEN) in a gravity flow column ...
-
bioRxiv - Developmental Biology 2021Quote: ... Luciferase reporter constructs were either mock-treated or methylated in vitro with SssI CpG methyltransferase for 4 h at 37 °C and purified with the QIAquick Purification Kit (QIAGEN 28704). Reporter plasmid (500 ng ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng of plasmid DNA was transfected into each well using Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427). Unless otherwise noted ...
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Molecular Biology 2021Quote: ... the PCR products were held at 4°C until PCR purification using the QIAquick PCR purification kit (#28106, Qiagen, Hilden, Germany). DNA concentrations were determined using NanoDrop 2000 (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 100μL chloroform were added and samples spun at 7000rpm for 15min at +4°C in a MaXtract column (Qiagen, Venlo, Netherlands). Mixed with 500μL 70% EtOH and spun at 10 000rpm for 30s at +4°C in a MiniElute column ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and ∼55 mg of total protein in CFE was incubated for 60 min at 4 °C with 2 mL of Ni-NTA agarose (QIAGEN, Germany) equilibrated with purification buffer A ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... The coverslips were then incubated for ~ 10 min with 4 μg/ml of Penta•His biotin conjugate antibody (34440, Qiagen, UK) in reaction buffer [40 mM HEPES buffer (pH 7.3 ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Cancer Biology 2022Quote: ... Variants in variant call format files were evaluated for pathogenicity using Ingenuity Variant Analysis (IVA) version 4 (Qiagen Inc, Alameda, CA) and American College of Medical Genetics and Genomics (ACMGG ...
-
bioRxiv - Microbiology 2022Quote: ... microbial genomic DNA (gDNA) was extracted from possum excreta samples using the DNeasy PowerSoil HTP 96 Kit (Qiagen Cat# 12955-4) following the manufacturer’s protocols just prior to the addition of solution C4 ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from NPCs and their derived astrocytes (4 lines, n=3 per cell type) using a RNeasy mini kit (Qiagen, 74104). RNA samples were prepped using TruSeq® Stranded mRNA Library kit (Illumina ...