Labshake search
Citations for Qiagen :
401 - 450 of 1477 citations for 2 3 Cyclohexenyl Ethyltrimethoxysilane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant from the second spin was incubated with 3 mL of Ni-NTA agarose beads (Qiagen) for 30 minutes at 4°C in the cold room ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from patient material (n=3) and organoids (xxx) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Bioengineering 2022Quote: ... messenger RNA (mRNA) combined from at least 3 gels were isolated with an RNeasy Mini Kit (Qiagen) and then reverse transcribed into complementary DNA (cDNA ...
-
bioRxiv - Immunology 2022Quote: ... DNA was extracted from frozen cell pellets (3×107 cells; Blood & Cell Culture DNA Maxi Kit, Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted (n=3) from the frozen endosperm tissue using the RNeasy PowerPlant kit (Qiagen). An on-column DNase digest was incorporated during the extraction ...
-
bioRxiv - Immunology 2024Quote: ... we transfected the 293T cells at 3 million cells/10 cm dish with Effectene transfection reagent (Qiagen) following manufacturer guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... Tissues were homogenized for five 3-minute cycles of 30 shakes/sec using a TissueLyser II (Qiagen) and transferred to an RNase free microfuge tube (Ambion ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Cancer Biology 2024Quote: The FASTQ file was analyzed by QIAseq UPX 3’ Transcriptome Primary Quantification tool (QIAGEN GeneGlobe analysis website) to generate gene expression matrix ...
-
bioRxiv - Cell Biology 2024Quote: ... RNase-A was degraded by the addition of proteinase-K (3 mAU/mL, 19131, Qiagen, Hilden, Germany) and inverting the tube briefly ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from 3 months old Pgrcre and FOXL2OE diestrus uteri using RNeasy mini kit (Qiagen). The library was prepared using TruSeq RNA Library Prep kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... beat-beading tubes were filled 1/3 with beads and soaked overnight in 500 μl buffer RLT (Qiagen). Tubes were spun at full speed and excess buffer removed ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-day-old seedlings using a QIAshredder and RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 µL PBS was added to each sample (lungs, 0.01–0.04 g) along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized at a speed of 10 Hz for 10 min and then centrifuged at 15,000 × g for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then ground to powder using a 3 mm tungsten carbide bead (Qiagen Cat. No. / ID: 69997) on a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were transfected at 3 DIV with siRNA targeting Kdm6a or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 500 µl of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized during 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then washed 3 times with PBS and lifted with 500µL/well of Cell Protect Reagent (Qiagen) for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... benthamiana leaves were grinded in a tube with two glass beads (3 mm) with a TissueLyser II (Qiagen) and directly after supplied with 600 μl EB ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from 3 dpf zebrafish AB larvae (50 fish) using RNAeasy Plus Kit (Qiagen 74134). cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we amplified samples (N=3 of each species) using the PyroMark PCR kit (Catalog #978703, Qiagen, Germantown, MD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: RNA isolation and qPCR – RNA was isolated from 3 x106 BMMCs using the RNeasy Plus kit (Qiagen, 74136) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and a 3 ml bacterial culture was collected for DNA extraction using the DNeasy Blood & Tissue kit (Qiagen). Sequencing libraries were made and commercially sequenced by Illumina sequencers in SeqCenter (https://www.seqcenter.com/) ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted from 3×106 SYAT or CGR8 cells with the Rneasy Plus Mini Kit (Qiagen, #74134). Reverse transcription was performed on 1 µg RNA using oligodT (Thermo Fisher Scientific #SO131 ...
-
bioRxiv - Bioengineering 2024Quote: ... Total RNA was extracted from 3 mm rings surrounding the initial punch wound using RNeasy Mini kit (Qiagen). The tissues from a pair of ear pinnae from each animal were pooled prior to RNA extraction so that each RNA sample represented one mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted from 3 – 5 x 106 cells using Rneasy kit with Dnase I treatment (QIAGEN), following manufacture instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Generation of cDNA was performed by GoTaq 2-step RT system (Qiagen). Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2-mercaptoethanol and purified using the RNeasy Micro kit (Qiagen).