Labshake search
Citations for Qiagen :
4251 - 4300 of 10000+ citations for Mouse 14 3 3 protein sigma SFN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen). Residual DNA was removed using RNAse-Free DNase Set (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNeasy® Plus Universal Mini Kit (Qiagen, Germany) was used to extract the total RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The DNA isolation kit (Qiagen DNeasy, Hilden, Germany) was used to isolate sperm genomic DNA according to the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... with QuantiTech SYBR Green PCR kit (Qiagen, 204141). The PCR protocol involved warming-up at 50°C for 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... using a QuantiNova Probe PCR Kit (Qiagen, 208254) following the kit protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and purified using QIAquick PCR Purification Kit (QIAGEN). The concentration and quality of the linearised plasmid were confirmed using NanoDrop Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... containing a Lysis buffer ((RNeasy Micro Kit (Qiagen)) ...
-
bioRxiv - Cell Biology 2024Quote: Was done using an miRNeasy Mini kit (Qiagen) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and gel purified (QIAquick Gel Extraction Kit; Qiagen) and transformed into DH5α competent cells (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... using DNeasy Blood & Tissue Kit (Qiagen, Germany, Hilden) with some modification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... either using the QIAquick Gel Extraction kit (Qiagen) or by soaking the plugs overnight in 100 ul nuclease-free water at 4 °C followed by 1 h at −80 °C and recovered at 23,000 x g ...
-
bioRxiv - Developmental Biology 2024Quote: ... extracted using the MinElute Gel Extraction Kit (Qiagen) according to the manufacturer’s protocol and sequenced by Genewiz (Azenta Life Sciences) ...
-
bioRxiv - Genetics 2024Quote: ... Purification with the QIAquick PCR purification Kit (Qiagen) was followed to proceed with the PCR amplification step ...
-
bioRxiv - Genetics 2024Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen) with on column DNase treatment and quantified with a Qubit RNA BR Assay kit (Molecular Probes) ...
-
bioRxiv - Immunology 2024Quote: ... and RNeasy Mini kit (QIAGEN Cat. No. 74104), respectively ...
-
bioRxiv - Genomics 2024Quote: ... using the AllPrep DNA/RNA mini kit (Qiagen). Poly-A RNA was isolated using Dynabeads oligo(dT)25 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... using QuantiNova SYBR Green PCR Kit (208054, Qiagen). All primer sequences are shown in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: Organoid RNA was isolated using RNAeasy kit (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cleaned-up using the RNeasy kit (Qiagen, UK) and cDNA was synthesized with the High Capacity cDNA Transcription kit (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... miRNeasy Mini kit for RNA isolation (Qiagen 217004), and nuclease-free water (Life Technologies AM9937 ...
-
bioRxiv - Immunology 2024Quote: ... and purification with an RNeasy purification kit (Qiagen). Recombinant WT SARS-CoV-2 full-length S protein and RBD (aa319-545 ...
-
bioRxiv - Immunology 2024Quote: ... Shank3b+/+ mice using RNeasy Plus Mini Kit (Qiagen), and retro-transcribed to cDNA as reported in our previous work (12,43) ...
-
bioRxiv - Microbiology 2024Quote: RNA extraction was performed using RNeasy Kit (Qiagen) according to supplier’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... coli using the QIAprep Spin Miniprep Kit (Qiagen). All plasmids made by PCR cloning were sequenced by Azenta ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted by RNeasy kit (QIAGEN), and cDNA was synthesized by Verso reverse transcription (Thermo Fisher Scientic ...
-
bioRxiv - Microbiology 2024Quote: Plasmid pDC-sgRNA was purified (Qiagen miniprep kit) and verified by nanopore sequencing (Plasmidsaurus) ...
-
bioRxiv - Microbiology 2024Quote: ... the QIAamp BiOstic Bacteremia DNA Kit (Qiagen, Germany), DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: DNA extraction with EZ1 DNA Investigator kit (Qiagen) was performed according to the manufacturer’s instructions and the large volume protocol [31] ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using the RNeasy Mini Kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... anophelis or ZIKV/DMEM using RNeasy kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... or QIAamp DNA Mini Kit (Qiagen, Cat#51304). Viral RNA was isolated by QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was purified using the RNeasy Kit (Qiagen) with on-column DNase digestion following the manufacturer’s protocol for gram-negative bacteria ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using the RNeasy Mini Kit (QIAGEN). sfGFP ...
-
bioRxiv - Bioengineering 2024Quote: ... or Qiagen DNeasy Powersoil Pro Kit (47016; Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by column-based purification (Qiagen RNeasy Kit). cDNA was generated from 250-1000 ng of total RNA using an iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted using RNeasy kit (Qiagen), according to manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The plasmid extraction kit was purchased from Qiagen GmbH (Hilden ...
-
bioRxiv - Synthetic Biology 2023Quote: ... QIAquick PCR purification kit was supplied by Qiagen. NucleoSpin® gel ...
-
bioRxiv - Genetics 2023Quote: ... The RNeasy Mini Kit from QIAGEN (Cat.#74104) was used to extract RNA from between 1 million and 5 million hiPSCs ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2023Quote: ... and purified with a miRNeasy mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the Qiagen MinElute Cleanup Kit (Qiagen, UK) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... or the RNeasy Mini Kit (Qiagen cat. 74104) paired with the QIAshredder columns (Qiagen 79656) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the QuantiFast SYBR Green PCR kit (Qiagen) for specific genes ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated using an RNeasy kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... bisulfite-treated using an EpiTect Bisulfite Kit (QIAGEN), and processed and hybridized to individual array wells of an Infinium Mouse Methylation BeadChip (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... we used a DNeasy Plant Mini Kit (Qiagen) to extract DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... by using a miRNeasy Mini Kit (217004, Qiagen). We confirmed whether total RNA ...