Labshake search
Citations for Qiagen :
4151 - 4200 of 10000+ citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... and then using the RNeasy Mini kit (Qiagen). Three replicates per strain and time point were performed ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was extracted using miReasy kit (Qiagen). For mRNA analysis ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted using RNeasy Kit (Qiagen) and cDNA synthesized with SuperScript III reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... and the RNeasy Plus Micro Kit from Qiagen was used to isolate total RNA ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... heart and brain using RNaesy mini kit (Qiagen). cDNA was synthesized using 500 ng of RNA ...
-
bioRxiv - Microbiology 2019Quote: ... Labeled probes were purified with RNeasy kit (Qiagen). Quality and quantity of RNA were controlled at each step by spectrometry (NanoDrop 1000 ...
-
bioRxiv - Molecular Biology 2019Quote: RNA was isolated with RNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified using QIAprep Spin Miniprep Kit (Qiagen) and then sequenced by Sanger sequencing to confirm mutagenesis (Eurofins Genomics).
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified using a miRNeasy mini kit (Qiagen). Nls-Cas9-nls104 mRNA was transcribed using the mMessage mMachine T3 kit (Life Technologies ...
-
bioRxiv - Immunology 2019Quote: ... and purified using the RNeasy Mini Kit (QIAGEN). Biotinylated RNA was incubated with cell lysate ...
-
bioRxiv - Systems Biology 2020Quote: ... isolated using the PureGene DNA isolation kit (Qiagen) according to the manufacturer recommendations ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using the DNeasy Blood and Tissue kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA was isolated with the RNeasy kit (QIAGEN), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... and purified using QIAquick gel extraction kit (Qiagen). The libraries were then pooled at equal concentrations and ran on a HiSeq × 2×151 bp run.
-
bioRxiv - Biochemistry 2020Quote: ... using the QuantiFast SyBr Green PCR Kit (Qiagen) and the following primers ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... HA-GLUT4 and HA-GLUT1 were extracted using AcsI and EcoRI restriction enzymes and Cutsmart buffer from NEB and the agarose gel extraction kit from Qiagen. The inserts were then ligated into the RUSH plasmid containing the ER Ii-hook fused to streptavidin ...
-
bioRxiv - Cell Biology 2019Quote: ... and RNA extracted using RNEasy extraction kit (Qiagen). RT-PCR was performed using Superscript Transcriptase III (ThermoScientific ...
-
bioRxiv - Microbiology 2019Quote: ... and further purified using a RNeasy kit (QIAGEN) according to manufactures’ instructions ...
-
bioRxiv - Immunology 2019Quote: ... mRNA was isolated using RNeasy Plus kits (Qiagen) and sequencing was performed on a Illumina NextSeq 500 (paired-end sequencing 2×75bp ...
-
bioRxiv - Molecular Biology 2020Quote: The Qiagen SYBR Green PCR kit (Qiagen, Germany) was used for real-time PCR ...
-
bioRxiv - Biochemistry 2019Quote: ... and QIAquick® Gel Extraction Kits (QIAGEN, Germany), were used to purify DNA bands excised from agarose gels ...
-
bioRxiv - Cancer Biology 2019Quote: ... or the AllPrep DNA/RNA Mini Kit (QIAGEN). RNA from tissue samples was isolated using the AllPrep DNA/RNA Mini Kit (QIAGEN) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and a miRNeasy mini kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was purified using the minElute kit (Qiagen). 6-10ng of immunoprecipitated material was used for ChIP-seq library preparation using the KAPA Hyper prep kit (KAPA Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... and purified with Endofree plasmid maxi kit (Qiagen).
-
bioRxiv - Systems Biology 2019Quote: ... root tips using the RNeasy Micro Kit (Qiagen). qPCR was performed with SYBR green (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... and purified with the RNeasy Mini Kit (QIAGEN). Folded RNAs (3 ug ...
-
bioRxiv - Immunology 2019Quote: ... and purified with the Gel Extraction Kit (Qiagen).
-
bioRxiv - Systems Biology 2019Quote: ... using the DNeasy Blood and Tissue Kit (Qiagen). The cDNA inserts were PCR-amplified using primers specific for either the N- or C-terminal libraries using Phusion DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: An RNeasy Micro Kit (Qiagen, Valencia, CA, USA) was used to extract total RNA as described before39 ...
-
bioRxiv - Microbiology 2019Quote: ... 1 ml RLT buffer (Qiagen RNA Isolation Kit) + 10 μl β-mercaptoethanol was added and vortexed and a phenol chloroform extraction followed by an ethanol precipitation was carried out ...
-
bioRxiv - Microbiology 2019Quote: ... using the DNA Blood and Tissue Kit (Qiagen). Phages and bacteria were quantified by qPCR (see above).
-
bioRxiv - Biochemistry 2019Quote: ... with the QuantiNova SYBR Green PCR Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... gel and the QIAquick Gel Extraction Kit (QIAGEN), recovered DNA amplified with secondary NGS PCR primers for 5 cycles ...
-
bioRxiv - Immunology 2019Quote: RNA was isolated using RNeasy mini kit (Qiagen) as per the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... For culture samples the RNeasy plus kit (QIAGEN) and SuperScript VILO (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted using RNeasy mini kit (Qiagen) following the manufacture’s protocol ...
-
bioRxiv - Genomics 2019Quote: RNA was extracted using RNeasy mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted using RNeasy Mini Kit (Qiagen) and cDNA was made using SuperScript™ III Reverse Transcriptase kit (Theremofisher) ...
-
bioRxiv - Genomics 2019Quote: RNA was extracted using miRNeasy micro kit (Qiagen) followed by DNase treatment (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... followed by purification using RNeasy mini kit (Qiagen) according to manufactures instructions.
-
bioRxiv - Genomics 2019Quote: ... was further purified using the MagAttract kit (Qiagen). Sequence-ready libraries were then prepared from 500 ng to 1 µg of intact (non-sheared ...
-
bioRxiv - Genomics 2020Quote: We used the RNAeasy Plus Mini Kit (Qiagen) to extract total RNA from the somatic tissues ...
-
bioRxiv - Genomics 2019Quote: ... or an EpiTect Bisulfite Kit (QIAGEN, Hilden, Germany), according to the manufacturers’ recommendations ...
-
bioRxiv - Genetics 2021Quote: A DNeasy Blood & Tissue kit (Qiagen, Tokyo, Japan) was used to extract the genomic DNA from muscle tissue (∼25 mg ...
-
bioRxiv - Genetics 2020Quote: ... or QIAamp DNA Blood Mini Kit (QIAGEN, Germany) and quantified using the Quantifiler Human DNA Quantification kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... total RNA was extracted using RNeasy kit (Qiagen) and 1µg of RNA was reverse transcribed using High Capacity cDNA Reverse Transcription kit according to manufacturer’s protocol (Applied Biosystems) ...
-
bioRxiv - Genomics 2020Quote: Using the QIAfilter Plasmid Midi Kit (Qiagen™), Plasmid DNA for each of the vectors was isolated from cultures of E ...
-
bioRxiv - Developmental Biology 2021Quote: ... then purified using QIAquick PCR purification kit (Qiagen). Amplicons were sequenced by Sanger sequencing using Exon2seqRev (CCCGCAATTACAACATGCTAG ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and RNeasy MinElute Cleanup Kit (Qiagen, Hilden, Germany). Strand-specific libraries were prepared using the NEBNext mRNA Library Prep Reagent Set for Illumina ...