Labshake search
Citations for Qiagen :
4101 - 4150 of 10000+ citations for Oxytocin ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... The DNA was extracted directly from the frozen samples using a commercial kit (DNeasy Power Soil Pro Kit, QIAGEN, Hilden, Germany), following the instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted for total RNA sequencing using the Direct-zol RNA Miniprep Kit (ZymoResearch R2050) or the miRneasy Mini Kit (Qiagen 217004) according to manufacturer protocols ...
-
bioRxiv - Immunology 2024Quote: ... Astrocytes were isolated using the Anti-ACSA-2 MicroBead Kit (Miltenyi, #130-097-678) and RNA extracted using RNeasy Micro Kit (Qiagen, # 74004). RNA library preparation ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid DNA was extracted using either a QIAGEN HiSpeed® Plasmid Midi Kit or Maxi Kit (QIAGEN Sciences, Germantown, MD, USA) as per the manufacturer’s instructions (HiSpeed® Plasmid Purification Handbook) ...
-
bioRxiv - Genomics 2021Quote: ... the detection of N-gene of SARS-CoV-2 was performed by using the 2019-nCoV-2 RUO kit (Integrated DNA Technologies, Inc., Coralville, Iowa, USA) and One-Step RT-PCR Kit (QIAGEN® GmbH) on a Rotor-Gene Q real-time PCR cycler (QIAGEN® GmbH) ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA from the cells and EVs were first isolated and purified using an RNeasy Mini Kit and a miRNeasy Serum/Plasma kit (Qiagen, Hilden, Germany), respectively ...
-
bioRxiv - Genomics 2019Quote: Joint RNA/DNA extractions were performed with the RNA PowerSoil Total RNA Isolation Kit combined with the RNeasy PowerSoil DNA elution kit (MO BIO Laboratories, Inc.; Qiagen, Hilden, Germany). About 5 g of sediment were used ...
-
bioRxiv - Pathology 2019Quote: Taxonomy filtered from samples was determined by analysis of kit controls with no template and zymo sequencing controls of know diversity and abundance (the QIAamp DNA Microbiome Kit (Qiagen, Hilden, Germany) DNA Clean and Concentrator Kit (Zymo Research) ...
-
bioRxiv - Neuroscience 2019Quote: ... and total RNA was isolated by using the RNeasy Lipid Tissue Mini Kit or RNeasy Plus Universal Mini Kit (Qiagen, Hilgen, Germany). Complementary DNA was synthesized by using the Omniscript RT Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA and genomic DNA were extracted using, respectively, the InviTrap® Spin Universal RNA Mini Kit (Stratec Biomedical, Germany) and the DNeasy Blood & Tissue Kits (Qiagen, Germany) according to manufacturers’ instruction ...
-
bioRxiv - Immunology 2021Quote: Total RNA from D+ and D- allografts or kidneys of MCMV infected- and uninfected-BALB/c mice was isolated and purified using the RNeasy Mini Kit and RNeasy MinElute Cleanup kit (Qiagen, Germantown MD) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: RNA was extracted from clarified cell culture supernatants (16,000 g x 10 min) and from infected cells using QIAamp Viral RNA Mini Kit and RNeasy Plus mini kit (Qiagen, Hilden, Germany), respectively ...
-
bioRxiv - Genetics 2020Quote: ... iris tissues were extracted using the Precellys 24 homogenizer and lysing kit (Bertin, Montigny-le-Bretonneux, France) together with the AllPrep DNA/RNA kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions including an on-column DNaseI digestion step using the RNase-free DNase Set (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was extracted and purified as described in [9] using the Quick-RNA MiniPrep Kit (Zymoresearch, Irvine, CA, USA) and RNeasy MinElute Cleanup Kit (QIAGEN, Hilden, Germany). Per sample at least 150 ng of high-quality RNA were obtained ...
-
bioRxiv - Molecular Biology 2021Quote: ... we extracted RNA using the RNeasy PowerSoil Total RNA Kit and DNA using the RNeasy PowerSoil DNA Elution Kit (Qiagen, Hilden, Germany). On each day of extraction (approximately every 5-15 samples) ...
-
bioRxiv - Microbiology 2022Quote: Total RNA samples were extracted from swab samples and tissue samples from the macaques using the QIAamp Viral RNA Mini Kit and RNeasy Plus Mini Kit (Qiagen, Venlo, Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: RNAseq: mRNA was extracted from the iPSCs of the pig-tailed macaque using RNeasy Mini Kit extraction kit (Qiagen Inc. Valencia CA). Following cDNA synthesis ...
-
bioRxiv - Genetics 2021Quote: ... and that of cultured cells was obtained using the AllPrep DNA/RNA/miRNA Universal kit or the miRNeasy mini kit (QIAGEN, Hilden, Germany). The samples were reverse-transcribed into cDNA with the High-Capacity cDNA reverse transcription kit (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... and the sediments were used to coextract the total RNA and DNA using the RNeasy PowerSoil Total RNA isolation kit and the DNA elution kit according to the manufacturer’s protocol (Qiagen®, Valencia, CA). To eliminate potential contaminant DNA in RNA samples ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from spiked blood (1×104 to 1 CFU/mL) using MolYsis Basic5 DNA extraction kit (Molzym, Bremen, Germany) combined with QIAamp UCP Pathogen Mini Kit (Qiagen, Venlo, Netherlands) following manufacturer instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Total RNA from the cells and EVs was isolated and purified using an RNeasy Mini Kit and a miRNeasy Serum/Plasma kit (Qiagen, Hilden, Germany), respectively ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: ... was extracted from whole cell RNA extracts (total RNA) using the miRNeasy Mini Kit and the RNeasy MiniElute Cleanup Kit (both Qiagen, Hilden, Germany). Extraction was performed according to the manufactureŕs instructions.
-
bioRxiv - Genomics 2023Quote: ... The bacteriomes of two individuals were dissected and total DNA was extracted using a commercial extraction kit (DNeasy Blood & Tissue Kit, Qiagen, Hilden, Germany), following the manufacturer’s instructions for purification of total DNA from animal tissues ...
-
bioRxiv - Cell Biology 2023Quote: ... Two different kits were used for this method depending on the primer set: Rotor-Gene SYBR® Green RT-PCR Kit (Qiagen, 204174) and SensiFAST™ SYBR® No-ROX One-Step Kit (BioLine ...
-
bioRxiv - Microbiology 2023Quote: ... DNA of the cell pellet was extracted using the Invisorb Spin Universal Kit (Invitek Molecular GmbH, Berlin, Germany) and RNA was extracted using the QIAamp RNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by genomic DNA removal and cleaning using Qiagen RNase-Free DNase Set kit (cat#79254) and Qiagen Mini RNeasy™ kit (cat#74104) (Qiagen, Denmark). Integrity of the RNA samples was assessed using the Alegient 2100 Bioanalyzer ...
-
bioRxiv - Microbiology 2023Quote: ... Clarified cell lysate was processed using a Qiagen RNeasy kit and in-column treatment with a DNase I kit (Qiagen, Germantown, MD) for purification of total RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA from samples was extracted as per manufacturer’s protocol (Qiagen, DNeasy Blood and Tissue Kit 69504 and Qiagen Genomic DNA miniPrep Kit) and SNP array derived genotypes generated by Affymetrix UK Biobank AxiomTM Array kit by Cambridge Genomic Services (CGS) ...
-
bioRxiv - Genomics 2022Quote: Total RNA was extracted from Min6 cells using RNeasy Plus mini kit and from pancreatic islets using RNeasy Plus micro kit (Qiagen, ref 74034) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: Microbiome DNAs were extracted from the human samples on the same day of collection using the microbiome-specific kit (QIAamp DNA Microbiome Kit; Qiagen, Hilden, Germany). The DNA extraction was performed according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... and colon (n = 35 each) and negative blank DNA extraction kit controls using the DNeasy PowerLyzer Powersoil kit (Qiagen, Germantown, MD, USA), with minor modifications to the manufacturer’s protocol as previously described51–53 ...
-
bioRxiv - Microbiology 2023Quote: ... The MDA reaction was performed using the Qiagen REPLI-g Mini kit and purified with the QIAamp DNA Mini kit (Qiagen, Hilden, Germany). Next ...
-
bioRxiv - Neuroscience 2024Quote: Total RNAs and miRNAs were extracted from the hippocampal tissue using the RNeasy Mini Kit and the miRNeasy Micro Kit (Qiagen Inc., USA), respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA (gDNA) or RNA from the tissues was isolated using a QIAamp DNA mini kit or RNeasy Plus kit (QIAGEN, Germantown, MA). Sequence encoding the modified capsid insertion was amplified using serotype-specific primers with PCR cycles less than 30 by using Q5 2x Master Mix (NEB ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acid (DNA and RNA) was extracted from BDB by PowerSoil DNA Isolation Kit or PowerSoil Total RNA Isolation Kit (Qiagen, Hilden, Germany). qPCR was carried out for viral and protozoan pathogens including enterovirus ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was collected and subjected to affinity purification using 5 mL Hi-Trap column containing Ni-NTA resin (Qiagen) on an AKTA Pure 25L protein purification system (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... and cDNA products containing the R2R adapter attached to their 5′ end were cleaned-up by using a MinElute column (Qiagen) to remove unused primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected at 60-80% confluence with 5 nM/1nM (MIN6, EndoCβ-H1, respectively) control or miR-125b mimics (Qiagen) or 50 nM of a mixture of four ONTARGETplus siRNAs against mouse Smad2 ...
-
bioRxiv - Microbiology 2019Quote: ... Epithelial cells were then recovered and stabilised by pelleting at 1000 rpm for 5 minutes followed by lysis in buffer RLT RNA lysis solution (Qiagen).
-
bioRxiv - Neuroscience 2022Quote: ... Cells were then aspirated using a freshly flame-pulled patch pipette (2.5 inner diameter) and placed into a 5 μl of lysis Buffer TCL (Qiagen, 1031576) + 1% 2-mercaptoethanol (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Immunology 2019Quote: ... Approximately 20 mg of jejunum were mixed with 600 μL of the prepared protein lysis buffer and homogenized using 5 mm stainless steel beads (Qiagen) and a TissueLyser II system (Qiagen) ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Immunology 2019Quote: ... mucosal scrapings and feces were homogenized in a 2 ml eppendorf containing 1 ml of DNA extraction buffer and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Evolutionary Biology 2019Quote: ... and dARC1 CA captured from clarified lysate using immobilised metal ion affinity on a 5 mL Ni2+-NTA superflow column (Qiagen). Bound dARC1 CA was eluted in non-reducing buffer (50 mM Tris-HCl ...