Labshake search
Citations for Qiagen :
351 - 400 of 10000+ citations for U3 Small Nucleolar RNA Associated Protein 4 Homolog CIRH1A Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Genetics 2021Quote: ... followed by protein precipitation with the Protein Precipitation Solution (Qiagen) for 10 min at -20 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... For the UCP4 antibody protein samples were extracted from the paraformaldehyde fixed tissue using the Qproteome FFPE Tissue Kit (Qiagen, Germany). The tissue blocks analyzed here were taken from the anterior cingulate and occipital cortex (as described above ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Evolutionary Biology 2021Quote: RNA-seq libraries from RNA extracted (the Qiagen plant RNA extraction kit) from two independent replicates were prepared using the TruSeq RNA sample preparation kit (Illumina Inc. ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted with the RNA Powersoil Total RNA kit from Qiagen.
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Neuroscience 2021Quote: ... The DNA was extracted from a small portion of the sample (∼25 mg) using the Qiagen DNeasy kit (Qiagen, German-town, MD). The mitochondrial COXI genes were amplified using Folmer’s universal COXI primers LCO1490 (5’-GGT CAA CAA ATC ATA AAG ATA TTG G ...
-
bioRxiv - Neuroscience 2023Quote: ... The left hippocampus was homogenized on ice in the lysis buffer from the AllPrep® DNA/RNA/Protein Mini Kit (QIAGEN, Hilden, Germany). A sample from the lysate was used to quantify total DNA and RNA content using the appropriate Qubit® Fluorometer kit (Cat ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was stabilized with RNA protect (Qiagen), and was collected using the RNEasy kit (Qiagen) ...
-
bioRxiv - Biochemistry 2022Quote: ... Extracted RNA (Qiagen viral RNA purification kit) was eluted in nuclease-free water as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA extraction was performed using the RNA-easy Micro RNA extraction kit (QIAGEN) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid library pool was isolated from overnight bacteria culture using QIAGEN HiSpeed Plasmid Midi (small pooled library) of maxi (TSS tiling library) kits (QIAGEN, 12643 and 12662). Lentivirus was produced from cloned plasmid pools in 293FT cells as described above ...
-
bioRxiv - Bioengineering 2024Quote: ... we isolated and purified total DNA from native and decellularized small intestine using a DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69504) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Ribosomal RNA was depleted from the total RNA using QIAseq fast select multi-RNA removal kit for mouse RNA(Qiagen) and then RNAseq libraries were made using NEB Next Ultra II Directional RNA library prep kit for Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... Protein extraction was conducted using a Qproteome Bacterial Protein Prep Kit (Qiagen)‡ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein-protein interaction networks were built using Ingenuity Pathway Analysis (IPA) (Qiagen).
-
bioRxiv - Neuroscience 2020Quote: ... RNA was purified using RNA easy microkit (Qiagen), with the addition of DNAse ...
-
bioRxiv - Microbiology 2023Quote: ... Viral RNA extraction (QiaAmp Viral RNA kit, Qiagen) was performed using a 140 μL volume of each nasal lavage sample or virus stock ...
-
bioRxiv - Microbiology 2023Quote: Viral RNA extraction (QiaAmp Viral RNA kit, Qiagen) was performed using a 140 μL volume of each nasal lavage sample ...
-
bioRxiv - Genetics 2021Quote: ... Protein Precipitation Solution (Qiagen) was added at 0.33x and mixed well ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Whole tissue protein was extracted by Qproteome Mammalian Protein Prep Kit (Qiagen, 37901) according to the manufacture’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated by adding 100 μL of a protein precipitation solution (Qiagen). Samples were centrifuged for 5 min at 13000 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted using the RNA extraction kit (Qiagen) according to the kit protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was purified using RNeasy RNA isolation kit (Qiagen) and quantified and quality-assessed by Bioanalyzer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Total RNA was extracted using QIAamp Viral RNA (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA was extracted (QIAamp Viral RNA Kits, QIAGEN) and used to generate the cDNA (SuperScript III ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was extracted (QIAamp Viral RNA Kits, QIAGEN) from the supernatants and served as the template for RT-PCR (SuperScript III ...
-
bioRxiv - Immunology 2022Quote: ... RNA was purified using PAXgene blood RNA kit (Qiagen) following manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2020Quote: RNAs were isolated using miRNeasy RNA isolation kit (Qiagen). We aligned 150bp paired-end reads to hg19 (UCSC ...
-
bioRxiv - Synthetic Biology 2020Quote: ... RNA was isolated using an RNA mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RNA was extracted using the RNA Minieasy Kit (Qiagen). The sequencing data was filtered with SOAPnuke (v1.5.2 ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted using an RNA-Easy kit (Qiagen) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was purified using RNeasy RNA isolation kit (Qiagen) and quantified and quality-assessed by Bioanalyzer ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted using RNA Easy Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted using RNA Easy Mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Virus RNA was extracted by Qiamp viral RNA (Qiagen) and quantified using Qbit 3 Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated using the RNA Mini Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed twice with the blocking buffer and incubated at 4 °C with primary antibodies (mouse anti-Strep, Qiagen, Cat #: 34850, 1: 150 dilution) (rabbit anti-PDI ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA for Illumina RNA-Seq was extracted with the RNEasy PowerSoil Total RNA kit (Qiagen, USA) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Genomics 2020Quote: ... Protein was precipitated by adding 200 µL of ice-cold Protein Precipitation Solution (Qiagen), gentle mixing and incubation on ice for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...