Labshake search
Citations for Qiagen :
351 - 400 of 1296 citations for PRG2 Protein Human Recombinant His Tag HPLC verified since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... We verified that products had amplified correctly using gel electophoresis and then extracted the DNA using a commercial kit (Qiagen QIAquick Gel Extraction Kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen). For analysis by TIDE ...
-
bioRxiv - Genomics 2022Quote: PCR amplicons verified by 1% agarose gel electrophoresis were purified from gel using Gel extraction kit (Qiagen GmbH, Hilden, Germany) and ligated into a pGEM-T easy cloning vector (Promega ...
-
bioRxiv - Immunology 2021Quote: ... Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen). For analysis by TIDE ...
-
bioRxiv - Immunology 2020Quote: ... The presence of the desired mutations in the viral genomes was verified by sanger sequencing of RT-PCR amplicons generated with the OneStep RT-PCR-kit (Qiagen) using LCMV WE GP-specific primers (GATTGCGCTTTCCTCTAGATC and TCAGCGTCTTTTCCAGATAG) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences of all constructs were verified by Sanger sequencing (Macrogen) and plasmids were purified prior to use (Midi plasmid kit, QIAGEN).
-
bioRxiv - Neuroscience 2023Quote: ... Amplicons were size-verified on a 4% agarose gel and PCR amplicons were extracted and purified (Qiaquick Gel Extraction Kit, Qiagen) before indexing (Nextera XT ...
-
bioRxiv - Molecular Biology 2023Quote: Size of PCR fragments was verified using gel electrophoresis and DNA was purified using the QIAquick PCR Purification Kit (Cat# 28104, Qiagen). Concentration was measured using a Quantus™ Fluorometer (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... All plasmids were verified by sequencing of the full receptor cDNA and purified with an EndoFree Plasmid Maxi Kit (Qiagen). cDNA sequences of all GPCR variants cloned in pcDNA3.1 are summarized in Data S2.
-
bioRxiv - Biophysics 2024Quote: ... Mutant cDNAs were then verified by Sanger sequencing (Eurofins Genomics) and purified on larger scale using a HiSpeed Plasmid Midi Kit (Qiagen).
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were probed with antibodies against His6 (penta-His Qiagen catalog #34460; 1:10,000), FLAG2 (Sigma catalog #A8592 ...
-
bioRxiv - Microbiology 2022Quote: ... After incubation with the primary antibody from QIAGEN (Penta-His Antibody, 1:1000 dilution) at RT for 1 h under shaking ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... SUMO-protease and SUMO-tag were captured using Ni-NTA beads (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen, Germantown, MD).
-
bioRxiv - Cancer Biology 2023Quote: The resulting inducible cell lines were verified to be correct by extracting genomic DNA (QIAmp DNA Blood Mini Kit Qiagen #51106) and sequencing through the S284 mutation site (Eurofins) ...
-
bioRxiv - Bioengineering 2023Quote: ... Recombinant plasmids were prepared by using the QIAprep Spin Miniprep Kit (QIAGEN) and confirmed by sequencing analysis ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Microbiology 2022Quote: ... BapR-CPD-His was affinity purified from cleared lysates using Ni-NTA agarose beads (Qiagen) with gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... the precipitates were subjected to Western blot analysis with anti-penta-His (1:2000, Qiagen) and anti-FLAG M2 (1:4000 ...
-
bioRxiv - Immunology 2022Quote: ... after which the cells were stained with anti-Penta-His-AF647 (1 µg/mL; Qiagen) for 30 minutes at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... The His-tagged IA2 was then purified with a NiNTA Agarose bead (Qiagen, Cat#1018244) packed column fraction collection ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Purification of C-terminal His6-tag-labeled GluN1 and GluN1ΔM4 by Ni2+-NTA agarose (Qiagen) chromatography was performed as in (Madry et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Correct introduction of the NS1 mutations was verified via cDNA synthesis of viral RNA using the One-Step RT-PCR kit (Qiagen, Hilden, Germany), amplification and sequencing using NS-specific primers ...
-
bioRxiv - Physiology 2024Quote: ... human TRPV4 and human Cx43 were amplified and purified using the HiSpeed® MidiKit (Qiagen). To identify Cx43 expression/distribution ...
-
bioRxiv - Microbiology 2020Quote: ... BipA-His was purified from the soluble fraction by affinity chromatography using Ni-NTA agarose (QIAGEN) previously equilibrated with equilibration buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6x-His-Smt3 was purified from BL21 E.coli cells using a Ni-NTA affinity column (Qiagen) following manufacturer indications ...
-
bioRxiv - Cancer Biology 2021Quote: ... Signal was detected using mouse anti-His antibody from Qiagen (Cat No./ID: 34660 1:500). Anti-mouse HRP was used for colorimetric development (Cat No./ID-A8924 1:1000) ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-tagged BASP1 derivatives were prepared using Ni-NTA beads following the manufacturers instructions (Qiagen). Purified proteins were dialysed into Buffer D and stored at −80°C.
-
bioRxiv - Immunology 2022Quote: ... and His-tagged Fabs were isolated from cell supernatants using Ni-NTA columns (Qiagen, Hilden, Germany). IgGs ...
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.
-
bioRxiv - Microbiology 2024Quote: ... sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using Penta-His antibody (QIAGEN)) were pooled and concentrated using Amicon filter devices with 10 kDa molecular weight cut-off (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... under p32 promoter to the recombinant expression using PCR Cloning Kit (Qiagen, Germany). The recombinant plasmids were named as pMG36e:nisA (nisA) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... recombinant plasmids were isolated using the QIAprep 2.0 Spin Miniprep Columns (Qiagen, Germany) and sequences were verified by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We verified the PCR products by 1% agarose electrophoresis with EtBr staining and purified using the QiaQuick PCR Purification Kit (Qiagen, Hilden, Germany, 28104) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Biophysics 2021Quote: ... Media containing his-tagged Ecads was passed through a chromatography column containing Ni-NTA agarose beads (Qiagen). Beads were then washed with a pH 7.5 biotinylation buffer (25mM HEPES ...
-
bioRxiv - Biochemistry 2020Quote: ... The primary antibodies were used at the following dilutions: 1:1000 anti-penta-His mouse monoclonal (Qiagen), 1:5000 anti-cMyc mouse monoclonal (Sigma) ...