Labshake search
Citations for Qiagen :
351 - 400 of 786 citations for Mouse Anti Human IgG Fab Alexa Fluor 568 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: RNA samples from freshly thawed human primary hepatocytes (SMC and AQL) or from PSC-hepatocytes were prepared with RNeasy plus micro kit (Qiagen), and 10-20 ng total RNA samples were used for constructing stranded RNA libraries with Swift RNA-seq library preparation kit and sequenced with an Illumina HiSeq 2500 sequencer with 50 base single end reads.
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... both hNS1 and hNP cells were transfected with human miRNA-mimics (double stranded RNAs that mimic mature endogenous miRNAs, Procured from Qiagen) of the mentioned ...
-
bioRxiv - Bioengineering 2020Quote: Total DNA samples were obtained from human skin biopsy samples (XX, caucasian, 79 yr) using the QIAamp DNA Mini Kit (Qiagen) and applied to the human Illumina Infinium EPIC 850K chip ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-seq FASTQ data were processed and mapped to the human reference genome (hg38) with the CLC Genomics Workbench 20 (Qiagen). Differential gene expression was analyzed with the DESeq2 package in R (Drummond et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN). After pelleting by centrifugation for 5 minutes at 5,000 x g ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Biochemistry 2022Quote: ... high molecular weight genomic DNA (gDNA) was purified from human primary T cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Gene expression of 84 heat shock genes in mock-infected or 229E-infected cells was analyzed using Human Heat Shock Proteins & Chaperones RT2 Profiler PCR array (Qiagen). Real-time PCR analyses were performed with specific primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Immunology 2023Quote: Real-time quantitative PCR (RT-qPCR) was done as previously described [Zonneveld 2021] using the Human T cell Tolerance & Anergy RT2 Profiler PCR array (Qiagen). The relative expression levels of each gene were normalized using 4 reference genes (B2M ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Immunology 2019Quote: ... Primary mouse CD4+ T cells were purified from lymph nodes and spleens by negative selection using anti-MHCII and anti-CD8 hybridoma supernatants (M5/114 and 2.43, respectively) and anti-rat Ig magnetic beads (Qiagen BioMag). The resulting CD4+ T cells were then immediately activated on 24-well plates coated with anti-CD3 and anti-CD28 (1 ug/ml each ...
-
bioRxiv - Molecular Biology 2020Quote: ... miRCURY LNA Power Inhibitor against mouse miR-375 (mmu-miR-375-3p) (Qiagen, Hilden ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA was extracted from mouse liver samples using RNeasy Mini Kit (Qiagen), DNase treated and 1 μg total RNA was processed for mRNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Pre-weighed cortex pieces from mouse brains were homogenized in QIAzol (Qiagen 79306), at 1ml volume per 100mg of tissue ...
-
bioRxiv - Physiology 2020Quote: Total RNA was isolated from mouse tissues using QIAzol Lysis Reagent Protocol (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA of mouse islets was extracted using RNeasy Plus Mini Kit (Qiagen). Other tissues including mouse liver ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the RNA from mouse liver was isolated using RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... we prepared total RNA from dissected wildtype mouse brain regions using Qiazol (Qiagen) and prepared cDNA using the SuperScript III first-strand synthesis kit (Invitrogen) ...
-
bioRxiv - Genetics 2019Quote: Total RNA was extracted from mouse pituitaries using an RNeasy mini kit (Qiagen) and 250 ng converted to cDNA using Revertra Ace (TOYOBO ...
-
bioRxiv - Genetics 2020Quote: Mouse tissues were disrupted and homogenized using QIAzol lysis reagent (Qiagen, Hilden, Germany) and the Tissue Lyser instrument (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... or RNeasy Mini Kit (synaptosome and cytosolic fraction from homogenized mouse forebrain; Qiagen). For RT-PCR ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse plasma was isolated using Qiamp RNA-mini isolation kit (Qiagen) and RNA from tissues isolated using the RNeasy mini isolation kit (Qiagen) ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was isolated from mouse B cells using the DNeasy kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Proteins were extracted from frozen mouse left ventricles using the TissueLyser LT (Qiagen) with 5mm stainless steel beads (69989 ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted from mouse neural retina using RNeasy mini kit (QIAGEN). Total RNA was reverse transcribed in the presence of PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time ...
-
bioRxiv - Physiology 2023Quote: ... total RNA was prepared from mouse liver using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2023Quote: We extracted RNA from fresh mouse using an AllPrep DNA/RNA kit (Qiagen). We placed 5-10 mg of tissue into 350 μL RLT Plus Buffer in a 2 mL tube containing a 5mm stainless steel bead and homogenized with a TissueLyzer for two 2 min rounds at 30 Hz ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse monoclonal antibody that recognizes the strep-tag epitope was purchased from Qiagen. Recombinant NifB expressed in E ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from mouse ESCs with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Immunology 2023Quote: ... Total mRNA was extracted from mouse tumors using the RNeasy Mini Kit (QIAGEN) and subsequently tested for concentration and integrity via NanoDrop 2000c (Thermo Fisher Scientific ...