Labshake search
Citations for Qiagen :
351 - 400 of 3255 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the QIAGEN One-Step RT-PCR Kit (QIAGEN, Hilden, Germany) in 50 μl reactions containing 10 μl 5x QIAGEN OneStep RT-PCR Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNAs were synthesized using one-step RT-PCR kit (Qiagen; 205311). To amplify specific cDNAs ...
-
bioRxiv - Physiology 2021Quote: One lobe of lung tissue was homogenized by a TissueLyser (Qiagen) in Trizol solution (Life Technology) ...
-
bioRxiv - Developmental Biology 2021Quote: ... one gonad with mesenephros was removed and kept in RNAlater (Qiagen) at -20°C until RNA extraction ...
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed using One Step RT-PCR kits (Qiagen) and a mixture of TRAV- ...
-
Temporal Dynamics of Neocortical Development in Organotypic Mouse Cultures: A Comprehensive AnalysisbioRxiv - Neuroscience 2024Quote: ... Tissue was homogenized by addition of one metal bead (steel, Qiagen) and 1 ml trizole (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (Qiagen, 911021). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Molecular Biology 2024Quote: ... and analysed using a One Step RT-PCR kit (Qiagen, #210210) following manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Genetics 2021Quote: ... and 7 healthy controls using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany) following the manufacturer isolation protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... extracted in phosphate buffer (pH = 7) and finely ground using Tissuelyzer II (Qiagen) with settings of 30 seconds at 30 Hz ...
-
bioRxiv - Immunology 2020Quote: ... Supernatants were collected 7 days later and bound with Ni-NTA Agarose (Qiagen) in 20mM Sodium Phosphate ...
-
bioRxiv - Bioengineering 2024Quote: ... the 3×Flag-MCS fragments in LV3-SFFV-3×Flag-MCS-GFP (QZ35395, QIAGEN) was replaced by DreAM though NotI and SpeI sites to produce the LV3-SFFV-DreAM-GFP plasmid ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genomics 2023Quote: ... and (d) Purify DNA using MinElute column (Qiagen) as directed by manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Systems Biology 2024Quote: ... NTA-agarose resin (1 mL) (Qiagen) was washed twice with 3 ml of distilled water and 2 ml of 100 mM FeCl3 in 0.1% acetic acid was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... SFPQ siRNA #1 (Qiagen Cat#SI05783848), and SFPQ siRNA #2 (Qiagen Cat#SI05783876 ...
-
bioRxiv - Plant Biology 2024Quote: ... mixed with 1% beta-mercaptoethanol (Qiagen) using Kimble Chase glass tissue grinders (part# KT885450-0020) ...
-
bioRxiv - Physiology 2020Quote: ... A one-step PCR kit (QuantiFast™ SYBR® Green, Qiagen, UK) was used to assess gene expression ...
-
bioRxiv - Plant Biology 2020Quote: ... Amplification was carried out using a One-Step RT-PCR Kit (QIAGEN) and BIO-RAD T100 Thermal Cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... one half of each cleanup prepared using MinElute PCR Purification Kit (QIAGEN) was treated with a cocktail of exonucleases comprising 0.2 U/μL T7 exonuclease ...
-
bioRxiv - Immunology 2022Quote: ... One part was extracted using the QIAamp Viral RNA Mini Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... All assays were adapted to the One-step RT-PCR Kit (Qiagen) reaction chemistry ...
-
bioRxiv - Molecular Biology 2023Quote: ... and one volume isopropanol before application to a Qiagen quickspin column (Qiagen) and elution according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (911021, Qiagen, USA). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Cancer Biology 2024Quote: ... For one-way qPCR (analysis of MAP3K1, Hs_MAP3K1_1_SG QuantiTect Primer Assay, Qiagen); Luna® Universal One-Step RT-qPCR Kit was used ...
-
bioRxiv - Neuroscience 2022Quote: ... one 5 mm bead per sample was used in a TissueLyser (Qiagen) for 4 min at 30 Hz ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... At least one specimen was placed in RNAlater solution (Qiagen, Hilden, Germany) for RNA preservation and frozen at −80 C within one week of collection to prevent RNA degradation ...
-
bioRxiv - Immunology 2023Quote: ... One biopsy was thawed on ice and homogenized in RLT buffer (Qiagen) employing the TissueLyser LT (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... One-fifth of the cells was used for plasmid DNA extraction (Qiagen). The remaining cells were used for RNA extraction using the innuPREP RNA Mini Kit 2.0 (Analytik Jena) ...
-
bioRxiv - Immunology 2024Quote: ... The One-step Syber Green RT-PCR Kit (Qiagen, Cat no. 210215) reagents were used to amplify the RNA and amplifications were monitored using the QuantStudio3 (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 5 PCRs were pooled and purified on one Qiaquick spin column (Qiagen) following manufacturer’s instructions.
-
bioRxiv - Genetics 2024Quote: A four-color assay using the QIAcuity One 5plex Device (Qiagen 911021) was used to measure excision frequency and specificity by single-step digital PCR as illustrated in Figure S16.