Labshake search
Citations for Qiagen :
351 - 400 of 3346 citations for 6 methyl N1 4 pyridin 3 yl thiazol 2 yl benzene 1 3 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... True Methyl oxBS Module and genomic DNA according to manufacturers’ instructions (Qiagen, NuGen respectively). Bisulfite treated DNA served as templates to PCR-amplify three DNA fragments of 350-400 bp long that cover the entire MLH1 promoter region using ZymoTaq PreMix according to manufacturer’s instructions (Zymo Research) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen): cDNA ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from 3 months old Pgrcre and FOXL2OE diestrus uteri using RNeasy mini kit (Qiagen). The library was prepared using TruSeq RNA Library Prep kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-day-old seedlings using a QIAshredder and RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 µL PBS was added to each sample (lungs, 0.01–0.04 g) along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized at a speed of 10 Hz for 10 min and then centrifuged at 15,000 × g for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then ground to powder using a 3 mm tungsten carbide bead (Qiagen Cat. No. / ID: 69997) on a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were transfected at 3 DIV with siRNA targeting Kdm6a or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 500 µl of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized during 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then washed 3 times with PBS and lifted with 500µL/well of Cell Protect Reagent (Qiagen) for 5 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Developmental Biology 2020Quote: ... benthamiana leaves were grinded in a tube with two glass beads (3 mm) with a TissueLyser II (Qiagen) and directly after supplied with 600 μl EB ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples from 3 independent cultures for each strain (Chr_dam and Chr_gfp) were extracted with RNeasy miniprep kit (Qiagen). Primers used are listed in Table S1 ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from 3 dpf zebrafish AB larvae (50 fish) using RNAeasy Plus Kit (Qiagen 74134). cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was then isolated for each biological replicate (3) using an RNeasy Lipid Tissue Mini kit (Qiagen). DNA contamination was removed using TURBO DNA-free (Ambion) ...
-
bioRxiv - Genomics 2024Quote: ... with two 3 mm metal beads and ground into a fine powder with a TissueLyser II (Qiagen, Germany) at 30 Hz for 2 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 2 mL salts mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen), and then incubated for 5 min at room temperature for stabilization before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the leaves of 4-to-6-week old plants using the RNeasy Plant Mini Kit (Qiagen). RNA concentrations were quantified using a Qubit RNA BR Assay Kit (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: ... We extracted total RNA from 10 leaves that were shorter than 500 µm and from 4–6 mature leaves using the RNeasy Micro Kit (Qiagen) and the RNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 250 to 1000 μm lengths of epithelium sections were microdissected from 4 to 6 successive serial sections and DNA extracted using a QIAMP DNA microkit (Qiagen) by digesting overnight and following manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA from 3×107 sorted GFP+ cells was extracted using the Blood & Cell Culture DNA Maxi Kit (Qiagen). Amplification of sgRNA regions from the extracted genome and the original sgRNA plasmid library ...
-
bioRxiv - Molecular Biology 2020Quote: ... while method-3 was a modified protocol of the DNeasy PowerMax Soil Kit (Cat.No. 12988-10) provided by Qiagen (based on communication exchanged with the manufacturer) ...
-
bioRxiv - Cell Biology 2019Quote: Transduced GFP+ LT-HSCs from 3 independent biological replicates were sorted directly into 350 ul of RLT buffer (Qiagen). Total RNA was isolated from cells using the RNeasy Micro kit (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was purified from cell passage number 3 using the RNeasy RNA purification kit (Qiagen Cat. No. 75142). A260:280 ratio > 2 and RIN > 9.
-
bioRxiv - Immunology 2021Quote: Bacterial plasmid DNA was extracted from a 3 ml overnight culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Next ...