Labshake search
Citations for Qiagen :
351 - 400 of 1651 citations for 6 METHYL 6 HEPTEN 4 YN 2 OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... 3-4 mL of Ni-NTA superflow resin (Qiagen) were loaded onto a column and equilibrated with the resuspension buffer ...
-
bioRxiv - Genomics 2019Quote: ... the Qiagen PowerMag kit (Qiagen, Cat# 27500-4-EP) was used for robot extractions while the Qiagen DNeasy PowerSoil kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... ears are collected on day 4 in RNAlater (Qiagen) and stored at 4° C until processed ...
-
bioRxiv - Cancer Biology 2023Quote: ... was lysed using 4% SDS and a qiashredder (Qiagen) and analyzed by Western blot.
-
bioRxiv - Neuroscience 2023Quote: ... into 4 μl Buffer TCL (1,031,576; Qiagen, Venlo, Netherlands) plus 1% 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 µl of 5X PCR buffer (Qiagen; Hilden, Germany), 0.8 µl of 10 mg/ml BSA (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Molecular Biology 2020Quote: ... was purified from curd stomach milk collected from P7 offspring that were exposed to mCHD (n=4) or mHFD (n=4) using a combination of QIAzol and miRNeasy Mini Kit (217004; Qiagen, Toronto, ON, CA) as described previously (Izumi et al. ...
-
bioRxiv - Bioengineering 2021Quote: DNA contents in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Physiology 2023Quote: DNA content in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... are prepared as follows: 4 µL of Vapor-Lock (Qiagen) is manually added to each well using a multichannel pipette followed by 2 µL of lysis buffer (0.2 µL of 25 µg/µL Qiagen Protease ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with 4 mg/mL RNase A (Qiagen 158922) diluted 1:286 in 2X SSC for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Systems Biology 2020Quote: ... the MoBioPowersoil 96 kit (now Qiagen Cat No./Id: 12955-4) was used with minor modifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4-5 hours later DNA was transfected using Attractene (Qiagen). Briefly ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of Buffer D2 (REPLI-g Single Cell Kit, Qiagen) and 1 μL of 500 μM exonuclease-resistant random primer were then added to the lysed cells to denature the DNA prior to vortexing ...
-
bioRxiv - Cell Biology 2022Quote: ... and TBT (4 biological replicates per condition) with RNeasy columns (Qiagen), followed by oligo-dT selection ...
-
bioRxiv - Systems Biology 2023Quote: ... or 4 pmol total negative control siRNA (Allstars negative control, Qiagen), were transfected using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated on 4-12% Bis-Tris gels (Novex, Qiagen) using MOPS running buffer (Novex ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...