Labshake search
Citations for Qiagen :
3851 - 3900 of 10000+ citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Plasmid DNA was isolated using miniprep kits (QIAGEN), with modifications for GBS as described elsewhere (32) ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted using the RNeasy kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated using Plant RNAeasy kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA was isolated using RNeasy kit (Qiagen) and cDNA was generated using iScript Advanced cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Genomics 2019Quote: ... Total RNA was isolated using RNeasy kit (Qiagen) and cDNA was generated using iScript Advanced cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Pathology 2020Quote: ... and RNeasy® Mini Kit (Qiagen, cat# 74104) coupled with on-column DNaseI treatment (Qiagen cat#79254 ...
-
bioRxiv - Molecular Biology 2020Quote: ... QIAShredder and RNeasy Mini kits were from Qiagen. Anti-WWOX antibody was from abcam (Cambridge ...
-
bioRxiv - Cancer Biology 2020Quote: ... the Quantitect Reverse Transcription kit (Qiagen, Hilden, Germany) was used according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by cleanup with RNAeasy Mini kit (Qiagen). The Superscript III first-strand synthesis kit (Invitrogen ...
-
bioRxiv - Systems Biology 2019Quote: ... RNA was extracted using the RNeasy Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... RNA was extracted using the RNeasy Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted with the miRNeasy kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the QiaAmp Blood mini kit (250, Qiagen) consisting of AL ...
-
bioRxiv - Biochemistry 2021Quote: Total RNA was isolated using RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and genomic DNA was isolated (Puregene kit, Qiagen). Purified genomic DNA was digested overnight with XhoI ...
-
bioRxiv - Neuroscience 2020Quote: ... lysis buffer (RNeasy Micro Kit, Qiagen, Maryland, USA) with β-mercaptoethanol (10µl/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and expanded with REPLI midi Kit (Qiagen, 150043). SOD1 Exon 1 was expanded using 20 µM of forward (CTATAAAGTAGTCGCGGAGACGGGGTG ...
-
bioRxiv - Developmental Biology 2021Quote: ... treatment and purification with an RNEasy kit (Qiagen). Embryo trunks were sectioned at 16µm on a cryostat (Leica CM1900 ...
-
bioRxiv - Genomics 2019Quote: ... using the DNeasy Blood and Tissue Kit (Qiagen). To confirm that the tumours and germline DNA were derived from the same patient ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted using the RNeasy kit (Qiagen), RNA quality was checked with a Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... RNA was isolated using RNeasy FFPE Kit (Qiagen). Isolated RNA was resuspended in RNAse/DNAse free H2O (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was purified by a MinElute kit (QIAGEN) and resuspended in 40 μl of Elution Buffer ...
-
bioRxiv - Microbiology 2021Quote: The QIAamp DNA mini kit (Qiagen, Hilden, Germany) was used for DNA extraction from Sterivex® filters (EMD Millipore ...
-
bioRxiv - Immunology 2019Quote: ... and purified using RNeasy MinElute Cleanup Kit (Qiagen). Purity and integrity of RNA was assessed using a Bioanalyzer 2100 with a Eukaryote Total RNA Nano chip (Agilent Technologies).
-
bioRxiv - Immunology 2020Quote: RNA was prepared using RNeasy micro kit (Qiagen). RNA quantity and quality was assessed using a Nanodrop 1000 Spectrometer (Peqlab ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... columns or the QIAquick Gel Extraction kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... and RNA was isolated using RNeasy Kit (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The Multiplex PCR Kit (Qiagen GmbH, Hilden, Germany) was used for PCR and sequencing was performed with the BigDye Terminator v.3.1 ...
-
bioRxiv - Neuroscience 2019Quote: ... followed by the RNeasy MinElute Cleanup Kit (Qiagen). Genomic DNA extraction was performed using the DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was extracted using miRNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted by miRNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA was extracted (DNeasy 96 Plant Kit, Qiagen). Genotyping of segregating seedling populations was performed by PCR using primers listed in Methods S3 ...
-
bioRxiv - Biochemistry 2019Quote: ... by using QuantiTect® Reverse Transcription Kit (Qiagen) and qRT-PCR was performed as described (38) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Genomic DNA was extracted using QiAMP kit (Qiagen) and PCR was performed in two steps ...
-
bioRxiv - Physiology 2020Quote: ... was extracted with the RNeasy Mini Kit (Qiagen) and processed for microarray at the core facility in the University of Chicago (Chicago ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the QIAsymphony DNA Mini Kit (Qiagen, Germany), following the manufacturer’s instructions and protocol.
-
bioRxiv - Cell Biology 2019Quote: ... and then with an RNeasy MiniElute kit (Qiagen) for cleanup ...
-
bioRxiv - Microbiology 2019Quote: ... DsRNA was purified using the RNeasy kit (Qiagen) and 0.2 μg in 69 nL was injected into the thorax of A ...
-
bioRxiv - Microbiology 2019Quote: ... or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... using the QIAxcel RNA QC Kit v2.0 (Qiagen) according to protocol ...
-
bioRxiv - Genomics 2021Quote: ... and pods) using an RNeasy Mini Kit (Qiagen) and treated with RQ1 RNase-Free DNase (Promega ...
-
bioRxiv - Genomics 2021Quote: ... DNA was purified via MinElute kit by Qiagen. qPCR was performed from this purified DNA described in the protocol to estimate the optimum number of enrichment cycles ...
-
bioRxiv - Genomics 2021Quote: ... first using PCR mini-elute purification kit (Qiagen) and then using 2.2x SPRI beads (Beckman-Coulter).
-
bioRxiv - Genetics 2020Quote: ... RNA was isolated using RNeasy Mini kit (Qiagen) adding the DNase I optional step or as described in detail before31 ...
-
bioRxiv - Genetics 2020Quote: ... with columns from the RNeasy Micro Kit (Qiagen) employed for the patellar ligament ...
-
bioRxiv - Genetics 2020Quote: ... or the RNeasy Plus Mini kit (Qiagen #74136) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted using miRNeasy Mini Kit (Qiagen). Libraries were prepared using 1 µg of high-quality total RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... treated and cleaned using RNeasy Mini Kit (Qiagen). The overall quality of an RNA preparation was assessed by electrophoresis on a denaturing agarose gel.
-
bioRxiv - Evolutionary Biology 2020Quote: RNA was isolated using RNeasy micro kit (QIAGEN) and resuspended in 15 μl of water ...
-
bioRxiv - Evolutionary Biology 2020Quote: RNA was isolated by RNeasy mini kit (Qiagen) from BJ5ta cells ...