Labshake search
Citations for Qiagen :
3751 - 3800 of 10000+ citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... or a Qiagen Plasmid Midi Kit (Qiagen, #12145). Correct insertions were verified by Sanger sequencing (Lightrunc ...
-
bioRxiv - Plant Biology 2024Quote: ... The RNeasy Plant Mini Kit (Qiagen, Venlo, Netherlands) was used for RNA extraction following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... for RNASeq and RNeasy mini kit (74106, Qiagen). A NanoDrop spectrophotometer (13400519 ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted using RNeasy Micro kit (Qiagen). RNAseq library preparation and RNA-sequencing was done using the SMARTer Total Stranded RNA pico kit ...
-
bioRxiv - Evolutionary Biology 2024Quote: DNA extraction was performed using a combination protocol between the NucleoSpin® Plant II kit from Macherey-Nagel and the DNeasy plant mini kit from QIAGEN. Approximately 2 g of each lichen sample was grinding and crushed with a mortar and pestle for distribution of the sample and convert the lichen samples into powder ...
-
bioRxiv - Pathology 2024Quote: ... and the miRNeasy Mini Kit (Qiagen; CA; USA). Total amount of isolated RNA was retrotranscribed using the MultiScribe Reverse Transcriptase kit 8 Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was harvested using a Rneasy kit (Qiagen), cDNA was generated with iScript (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the QIAamp Circulating Nucleic Acid kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated using RNeasy Micro Kit (Qiagen). RNA from the murine livers was isolated using TRIzol Reagent ...
-
bioRxiv - Microbiology 2024Quote: ... Dneasy Power Soil Kit (Qiagen GmbH, Hilden, Germany), following the manufacturers protocol with some modifications (i.e. ...
-
bioRxiv - Developmental Biology 2024Quote: ... and purified using the MinElute Cleanup kit (Qiagen). pUAST vector was double digested using EcoRI-HF and HpaI (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... QIAquick Gel extraction or PCR purification Kits (Qiagen) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... A QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) was used for DNA isolation from human midbrain samples according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: We used the DNeasy PowerSoil Pro Kit (Qiagen) for DNA extraction following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... recovered using a QIAquick gel extraction kit (Qiagen) and sequenced by Sanger sequencing to confirm their identity and to determine the sequence of the back-splice junction.
-
bioRxiv - Physiology 2024Quote: ... DNeasy Blood & Tissue Kits were used (QIAGEN #69506). After extraction ...
-
bioRxiv - Neuroscience 2024Quote: ... mRNA was isolated using RNeasy Mini Kit (Qiagen) and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs) ...
-
bioRxiv - Microbiology 2024Quote: ... was extracted with DNeasy PowerLyzer Microbial Kit (QIAGEN) to assess if the contamination was present in the original samples ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted by RNeasy kit (QIAGEN), and cDNA was synthesized by Verso reverse transcription (Thermo Fisher Scientic ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the QuantiFast SYBR Green PCR Kit (Qiagen). Thermocycling was done for 40 cycles in a two-step cycling in accordance with the manufacturer’s instructions and each PCR reaction was performed in triplicate ...
-
bioRxiv - Microbiology 2024Quote: ... and purified using QIAamp DNA Mini Kit (Qiagen). The purified DNA was tested for purity with a nanophotometer (Implen NP80 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified by Plasmid Maxi Kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Fecal DNA was extracted using PowerFecal kits (Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the RNeasy Mini kit (Qiagen). A sample for microinjection was prepared by mixing two guide RNAs in water (25 ng/μl for each ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNAs were extracted using RNeasy Mini Kit (Qiagen) and infection confirmed using RT-qPCR quantification of viral RNAs using specific primers pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the miRCURY LNA RT Kit (Qiagen, UK) was used to conduct qPCR in the Roche ® LightCycler® 480 according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... with QuantiTech SYBR Green PCR kit (Qiagen, 204141). The PCR protocol involved warming-up at 50°C for 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... using a QuantiNova Probe PCR Kit (Qiagen, 208254) following the kit protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Neuroscience 2024Quote: ... containing a Lysis buffer ((RNeasy Micro Kit (Qiagen)) ...
-
bioRxiv - Molecular Biology 2024Quote: DNA extraction with EZ1 DNA Investigator kit (Qiagen) was performed according to the manufacturer’s instructions and the large volume protocol [31] ...
-
bioRxiv - Molecular Biology 2024Quote: ... and purified using the RNeasy Mini Kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: Plasmid pDC-sgRNA was purified (Qiagen miniprep kit) and verified by nanopore sequencing (Plasmidsaurus) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The DNA isolation kit (Qiagen DNeasy, Hilden, Germany) was used to isolate sperm genomic DNA according to the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNeasy® Plus Universal Mini Kit (Qiagen, Germany) was used to extract the total RNA ...
-
bioRxiv - Immunology 2024Quote: ... and purified with RNeasy Mini Kit (74106, Qiagen) according to the manufacturer protocol ...
-
bioRxiv - Immunology 2024Quote: ... Following purification with the PCR Purification Kit (QIAGEN), fragment sizes were confirmed using the 2200 TapeStation and High Sensitivity D1000 ScreenTapes (Agilent) ...
-
bioRxiv - Cancer Biology 2024Quote: ... gel-extracted (QIAquick PCR & Gel Cleanup Kit, Qiagen), and Sanger sequenced (Elim Biopharm ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was isolated using an RNeasy kit (Qiagen) and reverse transcription was performed with the Quantitect kit (QIAGEN) ...
-
bioRxiv - Immunology 2023Quote: RNA was isolated using RNeasy Micro Kit (QIAGEN) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... was isolated using DNeasy Blood & Tissue Kit (QIAGEN) according to manufacturer’s protocol and normalized using NanoDrop (ThermoFischer Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... the QIAamp BiOstic Bacteremia DNA Kit (Qiagen, Germany), DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... miRCURY LNA SYBR® Green PCR Kit (Qiagen) was used for QRT-PCR according to manufacturer instructions and as described in (5).
-
bioRxiv - Cancer Biology 2023Quote: RNA was isolated using RNeasy micro kit (Qiagen) and RNA was converted to cDNA using Superscript III reverse transcriptase (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... anophelis or ZIKV/DMEM using RNeasy kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Organoid RNA was isolated using RNAeasy kit (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cleaned-up using the RNeasy kit (Qiagen, UK) and cDNA was synthesized with the High Capacity cDNA Transcription kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... and purified using the MinElute RNA kit (Qiagen). For all other cell lines ...
-
bioRxiv - Developmental Biology 2024Quote: ... and concentrated using a PCR purification kit (Qiagen). 3 µl of 10 µM stock tracRNA (IDT ...
-
bioRxiv - Bioengineering 2024Quote: ... or Qiagen DNeasy Powersoil Pro Kit (47016; Qiagen) following the manufacturer’s instructions ...