Labshake search
Citations for Qiagen :
3601 - 3650 of 10000+ citations for Human Oligodendrocyte transcription factor 1 OLIG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and a miRNeasy mini kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was purified using the minElute kit (Qiagen). 6-10ng of immunoprecipitated material was used for ChIP-seq library preparation using the KAPA Hyper prep kit (KAPA Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... and purified with Endofree plasmid maxi kit (Qiagen).
-
bioRxiv - Systems Biology 2019Quote: ... root tips using the RNeasy Micro Kit (Qiagen). qPCR was performed with SYBR green (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... and purified with the RNeasy Mini Kit (QIAGEN). Folded RNAs (3 ug ...
-
bioRxiv - Immunology 2019Quote: ... and purified with the Gel Extraction Kit (Qiagen).
-
bioRxiv - Systems Biology 2019Quote: ... using the DNeasy Blood and Tissue Kit (Qiagen). The cDNA inserts were PCR-amplified using primers specific for either the N- or C-terminal libraries using Phusion DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: An RNeasy Micro Kit (Qiagen, Valencia, CA, USA) was used to extract total RNA as described before39 ...
-
bioRxiv - Microbiology 2019Quote: ... using the DNA Blood and Tissue Kit (Qiagen). Phages and bacteria were quantified by qPCR (see above).
-
bioRxiv - Biochemistry 2019Quote: ... with the QuantiNova SYBR Green PCR Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... gel and the QIAquick Gel Extraction Kit (QIAGEN), recovered DNA amplified with secondary NGS PCR primers for 5 cycles ...
-
bioRxiv - Immunology 2019Quote: RNA was isolated using RNeasy mini kit (Qiagen) as per the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... For culture samples the RNeasy plus kit (QIAGEN) and SuperScript VILO (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted using RNeasy mini kit (Qiagen) following the manufacture’s protocol ...
-
bioRxiv - Genomics 2019Quote: RNA was extracted using RNeasy mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted using RNeasy Mini Kit (Qiagen) and cDNA was made using SuperScript™ III Reverse Transcriptase kit (Theremofisher) ...
-
bioRxiv - Genomics 2019Quote: RNA was extracted using miRNeasy micro kit (Qiagen) followed by DNase treatment (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... followed by purification using RNeasy mini kit (Qiagen) according to manufactures instructions.
-
bioRxiv - Genomics 2019Quote: ... was further purified using the MagAttract kit (Qiagen). Sequence-ready libraries were then prepared from 500 ng to 1 µg of intact (non-sheared ...
-
bioRxiv - Genomics 2020Quote: We used the RNAeasy Plus Mini Kit (Qiagen) to extract total RNA from the somatic tissues ...
-
bioRxiv - Genomics 2019Quote: ... or an EpiTect Bisulfite Kit (QIAGEN, Hilden, Germany), according to the manufacturers’ recommendations ...
-
bioRxiv - Genetics 2021Quote: A DNeasy Blood & Tissue kit (Qiagen, Tokyo, Japan) was used to extract the genomic DNA from muscle tissue (∼25 mg ...
-
bioRxiv - Genetics 2020Quote: ... or QIAamp DNA Blood Mini Kit (QIAGEN, Germany) and quantified using the Quantifiler Human DNA Quantification kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... total RNA was extracted using RNeasy kit (Qiagen) and 1µg of RNA was reverse transcribed using High Capacity cDNA Reverse Transcription kit according to manufacturer’s protocol (Applied Biosystems) ...
-
bioRxiv - Genomics 2020Quote: Using the QIAfilter Plasmid Midi Kit (Qiagen™), Plasmid DNA for each of the vectors was isolated from cultures of E ...
-
bioRxiv - Developmental Biology 2021Quote: ... then purified using QIAquick PCR purification kit (Qiagen). Amplicons were sequenced by Sanger sequencing using Exon2seqRev (CCCGCAATTACAACATGCTAG ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and RNeasy MinElute Cleanup Kit (Qiagen, Hilden, Germany). Strand-specific libraries were prepared using the NEBNext mRNA Library Prep Reagent Set for Illumina ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted using RNAeasy kit (Qiagen). The extraction was done from a pool of 48hpf larvae ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then transferred a RNeasy Mini Kit (Qiagen, ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was extracted using mRNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted using mRNeasy kit (Qiagen) according to the manufacturer’s instructions and concentration was determined with the Nanodrop (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The RNeasy Plus Mini Kit (QIAGEN, Germantown, MD) was used to extract total RNA and cDNA was generated with the Superscript III kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was extracted (RNeasy Micro Kit, QIAGEN), and cDNA synthesis was performed using random primers (iScript Select cDNA Synthesis Kit ...
-
bioRxiv - Microbiology 2021Quote: ... then sodium bisulfite-converted (EpiTect Bisulfite kit, Qiagen). The 5’LTR or the rev regions were amplified by (semi)nested PCR (primer sequences are available upon request) ...
-
bioRxiv - Genomics 2021Quote: ... for Gomphillus and DNeasy Plant Mini Kit (Qiagen) for the rest of the samples ...
-
bioRxiv - Immunology 2021Quote: ... 51 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Genomics 2019Quote: ... purified with a QIAquick Gel Extraction kit (Qiagen) and sequenced in both directions with the original set of primers on a 3730XL DNA Analyzer (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and purified by QIAquick Gel Extraction Kit (Qiagen). Libraries were sequenced on HiSeq 2500 instrument.
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using the RNeasy kit (QIAGEN) and 500 ng of each RNA sample was used to synthesise cDNA using Superscript III reverse transcriptase according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... RNeasy Protect Bacteria Mini Kit (Qiagen, Hilden, Germany) was used according to the supplier’s protocol for enzymatic lysis and proteinase K digestion of bacteria ...
-
bioRxiv - Synthetic Biology 2021Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen) and eluted in 80 µL H2O ...
-
bioRxiv - Microbiology 2021Quote: ... and QIAseq™ Library Quant Assay Kit (Qiagen). Then ...
-
bioRxiv - Evolutionary Biology 2020Quote: QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden) was used for the total genomic DNA extraction and purification from fecal samples of C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the QIAamp DNA Mini Kit (Qiagen, Germany). The DNA samples consisted of two samples from H ...
-
bioRxiv - Neuroscience 2020Quote: ... After purification using RNeasy MinElute Cleanup Kit (Qiagen), 300 pg of mFmn2-GFP capped RNA was co-injected with MO SB Fmn2 morpholino per embryo.
-
bioRxiv - Microbiology 2021Quote: ... and gel purified (QIAquick Gel Extraction Kit, Qiagen). Libraries were then quantified and sequenced with a 600 cycle MiSeq Reagent Kit (270×270 ...
-
bioRxiv - Microbiology 2021Quote: ... and gel purified (QIAquick Gel Extraction Kit; Qiagen). Libraries were then quantified (KAPA Library Quantification Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was extracted using the RNeasy kit (QIAGEN) and was subsequently treated with DNAse to remove genomic DNA (TURBO DNA-free kit ...
-
bioRxiv - Microbiology 2020Quote: ... microsporus using an RNeasy Plant Mini Kit (Qiagen) and sent to Novogene for library preparation and Illumina sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was isolated using the RNAeasy kit (Qiagen) and gene expression quantified by real-time PCR with primers listed in Supplementary Table 1.