Labshake search
Citations for Qiagen :
3551 - 3600 of 10000+ citations for Creatinine Serum Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... RNA was isolated via RNeasy Micro Kit (Qiagen), and RNA quality was analyzed using a TapeStation (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... The QIAamp MinElute Virus Spin Kit (QIAGEN, Germany) was used for viral nucleic acid extraction ...
-
bioRxiv - Molecular Biology 2022Quote: ... column cleanup (Qiaquick PCR purification kit, QIAGEN, 28104) to remove enzyme was done and is a crucial step prior to pooling to prevent cross-cutting of other plasmids in the pool after combination by still-active enzymes.
-
bioRxiv - Microbiology 2022Quote: ... 33] and separated with an AllPrep kit (Qiagen). RNA was DNase treated (TURBO DNase ...
-
bioRxiv - Plant Biology 2022Quote: ... and converted with an EpiTect Bisulfite Kit (Qiagen). Converted DNA was PCR-amplified by MyTaq polymerase (Bioline ...
-
bioRxiv - Physiology 2022Quote: ... were isolated using the RNeasy Mini kit (QIAGEN) following the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... purified with a RNeasy kit (Qiagen, Maryland, USA) and stored at −70°C until use ...
-
Simultaneous adjunctive treatment of malaria and its co-evolved genetic disorder sickle cell anaemiabioRxiv - Microbiology 2022Quote: ... and QIAamp RNA Blood Mini Kit (52304, QIAGEN), respectively according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... MEFs at 80% confluence using DNeasy kit (Qiagen). DNA was quantified on a Nanodrop and diluted to 4ng/μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... A Qiagen RNeasy mini kit (Qiagen, cat#: 74106) was used to harvest RNA for RNAseq and qPCR ...
-
bioRxiv - Cell Biology 2022Quote: ... purified using the QIAquick Gel Extraction Kit (Qiagen) and assessed for quality using a Fragment Analyzer (Agilent) ...
-
bioRxiv - Cell Biology 2022Quote: ... The QIAquick PCR Purification Kit (Qiagen cat. #28106) was used to isolate the PCR product following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen). Residual DNA was removed using RNAse-Free DNase Set (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Viral RNA extraction (QiaAmp Viral RNA kit, Qiagen) was performed using a 140 μL volume of each nasal lavage sample or virus stock ...
-
bioRxiv - Microbiology 2023Quote: ... Following PCR purification (Qiagen QiaQuick PCR Purification Kit), cDNA was processed at the ENPRC core for sequencing on an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Microbiology 2023Quote: Viral RNA extraction (QiaAmp Viral RNA kit, Qiagen) was performed using a 140 μL volume of each nasal lavage sample ...
-
bioRxiv - Neuroscience 2024Quote: ... and purified using QIAquick PCR Purification Kit (QIAGEN). The concentration and quality of the linearised plasmid were confirmed using NanoDrop Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DNA recovered using PCR purification kit (Qiagen).
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was purified using PCR purification kit (Qiagen) and eluted with 25 μl ddH2O.
-
bioRxiv - Biophysics 2024Quote: ... or a Qiagen Plasmid Midi Kit (Qiagen, #12145). Correct insertions were verified by Sanger sequencing (Lightrunc ...
-
bioRxiv - Plant Biology 2024Quote: ... The RNeasy Plant Mini Kit (Qiagen, Venlo, Netherlands) was used for RNA extraction following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... for RNASeq and RNeasy mini kit (74106, Qiagen). A NanoDrop spectrophotometer (13400519 ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted using RNeasy Micro kit (Qiagen). RNAseq library preparation and RNA-sequencing was done using the SMARTer Total Stranded RNA pico kit ...
-
bioRxiv - Evolutionary Biology 2024Quote: DNA extraction was performed using a combination protocol between the NucleoSpin® Plant II kit from Macherey-Nagel and the DNeasy plant mini kit from QIAGEN. Approximately 2 g of each lichen sample was grinding and crushed with a mortar and pestle for distribution of the sample and convert the lichen samples into powder ...
-
bioRxiv - Pathology 2024Quote: ... and the miRNeasy Mini Kit (Qiagen; CA; USA). Total amount of isolated RNA was retrotranscribed using the MultiScribe Reverse Transcriptase kit 8 Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was harvested using a Rneasy kit (Qiagen), cDNA was generated with iScript (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the QIAamp Circulating Nucleic Acid kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated using RNeasy Micro Kit (Qiagen). RNA from the murine livers was isolated using TRIzol Reagent ...
-
bioRxiv - Microbiology 2024Quote: ... Dneasy Power Soil Kit (Qiagen GmbH, Hilden, Germany), following the manufacturers protocol with some modifications (i.e. ...
-
bioRxiv - Developmental Biology 2024Quote: ... and purified using the MinElute Cleanup kit (Qiagen). pUAST vector was double digested using EcoRI-HF and HpaI (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... QIAquick Gel extraction or PCR purification Kits (Qiagen) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... A QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) was used for DNA isolation from human midbrain samples according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: We used the DNeasy PowerSoil Pro Kit (Qiagen) for DNA extraction following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... recovered using a QIAquick gel extraction kit (Qiagen) and sequenced by Sanger sequencing to confirm their identity and to determine the sequence of the back-splice junction.
-
bioRxiv - Physiology 2024Quote: ... DNeasy Blood & Tissue Kits were used (QIAGEN #69506). After extraction ...
-
bioRxiv - Neuroscience 2024Quote: ... mRNA was isolated using RNeasy Mini Kit (Qiagen) and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs) ...
-
bioRxiv - Microbiology 2024Quote: ... was extracted with DNeasy PowerLyzer Microbial Kit (QIAGEN) to assess if the contamination was present in the original samples ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was extracted by RNeasy kit (QIAGEN), and cDNA was synthesized by Verso reverse transcription (Thermo Fisher Scientic ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the QuantiFast SYBR Green PCR Kit (Qiagen). Thermocycling was done for 40 cycles in a two-step cycling in accordance with the manufacturer’s instructions and each PCR reaction was performed in triplicate ...
-
bioRxiv - Microbiology 2024Quote: ... and purified using QIAamp DNA Mini Kit (Qiagen). The purified DNA was tested for purity with a nanophotometer (Implen NP80 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified by Plasmid Maxi Kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Fecal DNA was extracted using PowerFecal kits (Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the RNeasy Mini kit (Qiagen). A sample for microinjection was prepared by mixing two guide RNAs in water (25 ng/μl for each ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNAs were extracted using RNeasy Mini Kit (Qiagen) and infection confirmed using RT-qPCR quantification of viral RNAs using specific primers pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the miRCURY LNA RT Kit (Qiagen, UK) was used to conduct qPCR in the Roche ® LightCycler® 480 according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... with QuantiTech SYBR Green PCR kit (Qiagen, 204141). The PCR protocol involved warming-up at 50°C for 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... using a QuantiNova Probe PCR Kit (Qiagen, 208254) following the kit protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Neuroscience 2024Quote: ... containing a Lysis buffer ((RNeasy Micro Kit (Qiagen)) ...
-
bioRxiv - Molecular Biology 2024Quote: DNA extraction with EZ1 DNA Investigator kit (Qiagen) was performed according to the manufacturer’s instructions and the large volume protocol [31] ...