Labshake search
Citations for Qiagen :
3501 - 3550 of 10000+ citations for Human Midkine ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was extracted using miRNEasy mini kit (Qiagen) with on-column DNase digestion (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: RNA was isolated by RNeasy Plus Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA synthesis was performed with Omniscript RT Kit (Qiagen). qPCR was carried out using Power SYBR Green PCR Master Mix (ThermoFisher SCIENTIFIC ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated using RNeasy Mini Kit (Qiagen). On-column DNase digestion step was performed during the isolation process ...
-
bioRxiv - Molecular Biology 2020Quote: ... and QIAquick PCR Purification kit (cat. no. 28104, Qiagen) was used to clean the plasmid digest according to vendor instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was removed with the DNase Max Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCRs were purified with the PCR cleanup kit (Qiagen), and subjected to next generation sequencing with sequencing primer TGATTGACTACCCGTCAGCGGGGGTCTTTCA and indexing primer TATACTTTCTAG+A+GAATAGGAACTTCGGAATA+G+GAACT (+N = LNA modification).
-
Capacity to erase gene occlusion is a defining feature distinguishing naive from primed pluripotencybioRxiv - Molecular Biology 2021Quote: Bisulfite sequencing was performed using EpiTech Bisulfite Kit (QIAGEN) following vendor’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and RNA was isolated with RNeasy mini kit (Qiagen).
-
bioRxiv - Molecular Biology 2021Quote: ... The samples were then processed using RNeasy kit (QIAGEN), following the “RNA clean-up” protocol enclosed with the kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified using the QIAquick PCR Purification Kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was purified using Qiaquick PCR purification Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA was prepared using the miRNeasy Mini Kit (Qiagen), including an on-column DNase digest (Qiagen).
-
bioRxiv - Molecular Biology 2019Quote: ... and RNA prepared using the miRNeasy Mini Kit (Qiagen). For RNA extraction from animal tissues ...
-
bioRxiv - Cell Biology 2022Quote: RNA was purified using a RNeasy Kit (Qiagen,74106) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2022Quote: ... Total mRNA was isolated using Extraction Mini Kit (Qiagen) following the recommendations of the manufacturer.
-
bioRxiv - Cell Biology 2022Quote: RNA was isolated with the RNAeasy Plus kit (QIAGEN) from 500-900 x 103 cells ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... homogenized tissue with RNeasy mini or midi kits (Qiagen) according to manufacturer’s instructions and reprecipitated if necessary ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was purified using RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... DNA was obtained with a Qiagen MinElute Kit (Qiagen). Libraries were prepared with KAPA HiFi High sensitivity Real-time PCR master mix ...
-
bioRxiv - Immunology 2022Quote: ... and RNA was extracted (RNeasy Plus mini kit, Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... total RNA was extracted using RNeasy Mini Kit (Qiagen) and treated with DNase I according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... DNA was extracted using DNeasy blood/tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from cell lysates (Qiagen RNeasy kit) and IFIT1 expression was measured by qRT-PCR (IDT Assay ID Hs.PT.561.20769090.g).
-
bioRxiv - Genomics 2020Quote: ... and purified using a QIAquick PCR purification kit (Qiagen). Assembly was performed with 1650 ng of BsmBI-digested pLentiCRISPRv2 and 250 ng of amplicon in a total reaction volume of 100 μL with HiFI DNA Assembly Mix (NEB ...
-
bioRxiv - Genomics 2020Quote: ... We extracted DNA using the DNeasy Plant Kit (Qiagen) or a modified CTAB protocol (Doyle and Doyle 1987) ...
-
bioRxiv - Genomics 2020Quote: ... sinensis using a DNeasy® Plant Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... Amplicons were purified using MinElute PCR Purification kit (Qiagen) eluting with 15uL molecular grade water ...
-
bioRxiv - Immunology 2021Quote: ... The allPrep DNA/RNA Mini Kit (Qiagen; cat. 80204) was used for DNA isolation ...
-
bioRxiv - Genomics 2020Quote: ... using the QIAamp Viral RNA Mini Kit (Qiagen, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... followed by purification with Qiagen PCR purification kit (Qiagen). The purified ligated DNA was subject to PCR amplification with Q5 high-fidelity DNA polymerase (NEB) ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted using the RNeasy Micro Kit (Qiagen). RNA was treated with DNase and cDNA was synthesized using Multiscribe reverse transcriptase (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified by Qiaquick PCR DNA purification kit (Qiagen). The eluted DNA material was A-tailed by Klenow Fragment (3C to 5C exo minus ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by purified by MinElute PCR purification Kit (Qiagen). Illumina Multiplex Adapters (MPA ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers were purified by MinElute PCR Purification Kit (QIAGEN), to do the fusion PCRs ...
-
bioRxiv - Bioengineering 2019Quote: ... and the exoRNeasy Serum/Plasma Starter Kit (Qiagen, 77023) following the vendor’s instruction ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Total RNA was extracted using RNAsay mini-kit (Qiagen). The quality and purity of RNA were assessed by OD260/280 ratio ...
-
bioRxiv - Developmental Biology 2019Quote: ... RNA was extracted using the RNeasy Micro kit (Qiagen) following the manufacturer’s protocol that included an on-column DNase treatment step ...
-
bioRxiv - Cell Biology 2019Quote: ... We utilized the DNeasy Plant Mini Kit (QIAGEN #69104) to extract DNA as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and RNA was isolated using the RNeasy kit (QIAGEN) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... the concentration was increased (MinElute PCR purification kit; Qiagen) and an Illumina-compatible library was prepared using the Ovation® Ultralow Library Systems kit (NuGEN ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was extracted using DNeasy PowerSoil Kit (QIAGEN, Germany). PCR was performed using the forward primer 515F (5’-GTGCCAGCMGCCGCGGTAA-3’ ...
-
bioRxiv - Genomics 2019Quote: ... samples were purified with MIniElute PCR purification kit (Qiagen) or with DNA Clean & Concentrator kit (Zymo) ...
-
bioRxiv - Cancer Biology 2020Quote: ... individually isolated using a Gel Extraction Kit (QIAGEN, 28704), analyzed by Sanger sequencing (Eton Bioscience ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA was isolated with the RNeasy Plus kit (Qiagen), following the manufacture’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... DNA was purified using QIAamp DNA Mini Kit (QIAGEN).
-
bioRxiv - Evolutionary Biology 2019Quote: ... RNA purification was performed using the RNeasy kit (Qiagen), while for S ...
-
bioRxiv - Plant Biology 2019Quote: ... RNA was extracted with an RNeasy Mini Kit (QIAGEN) with an on-column treatment with DNase (QIAGEN) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA purified using the QIAamp DNA mini kit (QIAGEN), and products analyzed using SYBR green qPCR or a 30-cycle end point PCR ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated using RNeasy Plus Mini Kit (Qiagen) and reverse transcribed to cDNA with iScript cDNA Synthesis Kit (Bio-Rad) ...