Labshake search
Citations for Qiagen :
3451 - 3500 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted with the RNeasy Micro kit (QIAGEN), according to manufacturer’s instructions and quantified with a spectrophotometer ...
-
bioRxiv - Genomics 2021Quote: Total RNA was extracted with the miRNeasy kit (Qiagen) and reverse transcribed using random hexamers and the High Capacity reverse transcription system from Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the DNeasy Blood & Tissue Kit (QIAGEN, Valencia, CA) following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The PureGene Genomic DNA Tissue Kit (QIAGEN no. 158622) and a supplemental nematode protocol were used for isolation of gDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA was extracted using an RNeasy Mini Kit (Qiagen), following the manufacturer’s protocol for Total RNA Purification from Animal Cells ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was extracted using the RNeasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: RNA harvest was performed with miRNeasy Micro Kit (Qiagen) and cDNA synthesized with miScript II RT kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... and cDNA synthesized with miScript II RT kit (Qiagen) using miScript HiFlex buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA was purified using Minelute PCR Purification Kit (Qiagen), pooling all aliquots in a single column ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Total RNA purified using RNeasy Mini Kit (Qiagen). cDNA libraries were made using SuperScript-III (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... After purification of the amplicons (PCR purification kit; Qiagen) and cloning into pGEM-T-easy ...
-
bioRxiv - Developmental Biology 2020Quote: The QIAmp DNA Blood Mini Kit (Qiagen, cat.: 51106) was used to extract genomic DNA (gDNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... and further processed via the RNeasy mini kit (Qiagen). RNA was collected from 3 independent differentiations ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by clean-up with RNeasy Mini-Kit (Qiagen). RNA Integrity Number (RIN ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were extracted with the RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was extracted using RNeasy mini kit (Qiagen). For mouse E14 brain ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid preparations (Qiagen mini prep kit Cat no.27106) were sequenced using plasmid-specific primers (Table S5) ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was extracted with miRNeasy Mini Kit from Qiagen. The levels of mRNA for the fibrogenic genes were quantified by RT-qPCR and normalized to GAPDH expression.
-
bioRxiv - Molecular Biology 2022Quote: ... and purified using a QIAquick PCR Purification kit (Qiagen). DNA oligonucleotides and gBlocks were obtained from IDT (https://www.idtdna.com) ...
-
bioRxiv - Cancer Biology 2022Quote: ... extracted using the Qiagen RNeasy plus kit (Qiagen 74034) and quantified using a NanoDrop (Thermo Fisher Scientific - ND-2000-US-CAN) ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA was isolated using RNeasy Mini kit (Qiagen), treated with DNase (RNase-Free DNase Set ...
-
bioRxiv - Neuroscience 2022Quote: ... Probes were purified according to the “RNeasy Kit” (QIAGEN) and eluted in 40ul RNase-free water ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA isolation was performed using RNeasy Micro Kit (QIAGEN) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... In vitro transcripts were purified with RNeasy kit (Qiagen). Flag-RtcB WT and Flag-RtcB Y306F proteins were purified from HeLa cells stably expressing the two proteins ...
-
bioRxiv - Genomics 2022Quote: RNA purification was performed with RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... using the QIAquick® Gel Extraction Kit (Qiagen #28706) following the manufacturer’s instruction ...
-
bioRxiv - Immunology 2022Quote: ... RNA extractions were performed using RNeasy Mini Kit (Qiagen) and cDNA was synthesized from RNA samples using SuperScript III First-Strand synthesis system (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... using a RNeasy Plus Mini Kit (Qiagen, Valencia, CA). RNA was reverse transcribed with a Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Sciences ...
-
bioRxiv - Neuroscience 2021Quote: ... mRNA was isolated with RNeasy mini kit (74104, Qiagen). RNA integrity was measured using Agilent 2100 Bioanalyzer (RIN value >= 9.2 for each sample) ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using Quantitect Reverse Transcription Kit (QIAGEN) from 200 ng isolated mRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... plasmids were purified using Plasmid Plus Purification Kit (Qiagen) and injected into w ...
-
bioRxiv - Neuroscience 2021Quote: ... and then purified using RNeasy Plus mini kit (Qiagen). RNA-sequencing was carried out by HiSeq4000 ...
-
bioRxiv - Cell Biology 2020Quote: RNA was prepared using an RNeasy Mini kit (QIAGEN) and cDNA was synthesized with SuperScript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen), prepared for qPCR using a SYBR Green qPCR master mix (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was isolated using RNeasy plus kit (Qiagen). To guarantee extensive elimination of genomic DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by addition purification using RNeasy Mini Kit (QIAGEN), per manufacturer recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the QIAseq miRNA Library Kit (Qiagen, Valencia, CA). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... The miRCURY LNA SYBR green kit (Qiagen. cat# 339345) was used as per manufacturer’s protocol and the reaction was set in Roche LightCycler 480 ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA is made with QuantiTect Reverse Transcription Kit (Qiagen). qPCR is performed to quantify the reporters (27 ...
-
bioRxiv - Neuroscience 2020Quote: ... and RNAs were isolated using RNeasy Micro Kit (Qiagen). 10% of the beads were used for WB and eluted in Laemmli sample buffer (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was purified using Qiaquick PCR purification kit (Qiagen). For Spt4/5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was extracted using miRNEasy mini kit (Qiagen) with on-column DNase digestion (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: RNA was isolated by RNeasy Plus Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA synthesis was performed with Omniscript RT Kit (Qiagen). qPCR was carried out using Power SYBR Green PCR Master Mix (ThermoFisher SCIENTIFIC ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated using RNeasy Mini Kit (Qiagen). On-column DNase digestion step was performed during the isolation process ...
-
bioRxiv - Molecular Biology 2020Quote: ... and QIAquick PCR Purification kit (cat. no. 28104, Qiagen) was used to clean the plasmid digest according to vendor instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was removed with the DNase Max Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCRs were purified with the PCR cleanup kit (Qiagen), and subjected to next generation sequencing with sequencing primer TGATTGACTACCCGTCAGCGGGGGTCTTTCA and indexing primer TATACTTTCTAG+A+GAATAGGAACTTCGGAATA+G+GAACT (+N = LNA modification).
-
Capacity to erase gene occlusion is a defining feature distinguishing naive from primed pluripotencybioRxiv - Molecular Biology 2021Quote: Bisulfite sequencing was performed using EpiTech Bisulfite Kit (QIAGEN) following vendor’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and RNA was isolated with RNeasy mini kit (Qiagen).