Labshake search
Citations for Qiagen :
301 - 350 of 2160 citations for Recombinant Human IIntercellular Adhesion Molecule 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant plasmids were purified with EndoFree Plasmid Maxi Kit (12362, QIAGEN). Oligonucleotide sequences and further details are provided in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant protein was initially purified by nickel affinity chromatography (Qiagen, Holland) and subsequent size exclusion using Superdex 200 increase (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Uhrf1 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 40,920 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Swi6 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 45,330 cm-1 M-1) ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant HCMVs were reconstituted from HCMV BAC DNA by Superfect (Qiagen) transfection into permissive MRC-5 cells.
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Ni2+-nitrilotriacetic acid agarose beads (Qiagen) and desalted with Bio-Gel P-6DG gel (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant protein was purified by binding to Ni-NTA beads (Qiagen) and eluted in the same buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 200nM siRNA/well were used for transfection using 5µl/well of Hi-Perfect (Qiagen) following manufacturer’s recommendation.
-
bioRxiv - Biophysics 2021Quote: ... coli and purified by His-tag affinity purification using Ni-NTA agarose beads (Qiagen) followed by ion exchange purification using a mono-Q HR 5/5 column (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Plant Biology 2020Quote: ... His-βC1 fusion proteins were purified using Ni-nitrilotriacetate (Ni-NTA) agarose (Qiagen, 30210) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Immunology 2021Quote: ... Insoluble material was removed by centrifugation and 6xHis-tagged protein was purified using Ni-NTA (Qiagen) and gravity chromatography ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant containing hexahistidine-tagged proteins was passed over a column of Ni2+-NTA matrix (Qiagen) at 0.5 mL matrix / 1 L of culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The His6-tagged protein was purified by affinity chromatography on Ni-NTA agarose beads (Qiagen 30230) and cleaved on beads with TEV protease o/n at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... the resolubilized histidine-tagged histones were purified with Ni affinity chromatography using Ni-NTA beads (Qiagen). For untagged H2B ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant containing the polyhistidine-tagged toxin was loaded onto a Ni-NTA agarose column (Qiagen). The column was then washed with a 20–120 mM gradient of imidazole to remove additional contaminating proteins ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Microbiology 2022Quote: ... the recombinant protein was purified by Ni-NTA affinity chromatography column (QIAGEN).
-
bioRxiv - Microbiology 2019Quote: ... Recombinant protein in the supernatant was purified via Ni2+-NTA (Qiagen, UK) column [20].
-
bioRxiv - Biophysics 2021Quote: ... The recombinant proteins were purified from lysates on Ni-NTA columns (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Bioengineering 2023Quote: ... Recombinant plasmids were prepared by using the QIAprep Spin Miniprep Kit (QIAGEN) and confirmed by sequencing analysis ...
-
bioRxiv - Biochemistry 2020Quote: ... The His-tag protein was purified by using a column of Ni-Sepharose 4B (Qiagen), followed by gel filtration using a Superdex 75 column (G.E ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Microbiology 2022Quote: ... BapR-CPD-His was affinity purified from cleared lysates using Ni-NTA agarose beads (Qiagen) with gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... containing an N-terminal His-tag was removed on a Ni-NTA agarose column (Qiagen). Proteins were additionally purified through a Superdex 200 26/60 size exclusion column (Pharmacia Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... MCP (His-HaloTag-2xMCP) was purified using its histidine tag with Ni-NTA Agarose (Qiagen) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Microbiology 2023Quote: ... and were probed with either horseradish peroxidase (HRP)- conjugated primary antibodies against His-tag (Qiagen) or with rabbit primary antibodies against HA-tag (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... His-tag-affinity chromatography-purifcation was performed with a Ni-NTA agarose (Qiagen, Hilden, Germany) gravity flow column ...
-
bioRxiv - Microbiology 2020Quote: ... Gravity column was used for purification with His6-tagged Mpro binding to Ni-NTA beads (Qiagen 30210), washed with lysis buffer + 10mM imidazole and eluted with increasing concentration of imidazole (50mM ...
-
bioRxiv - Microbiology 2022Quote: ... 6xHis tagged protein were purified by immobilized metal ion chromatography using nickel-NTA super flow resin (Qiagen) as previously described with slight modifications46 ...
-
bioRxiv - Biochemistry 2023Quote: ... His6-tagged cleavage products as well as TEV protease were removed with Ni-NTA agarose resin (Qiagen) on gravity flow disposable plastic columns ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were affinity purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) and elution with imidazole ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The recombinant proteins were purified under denaturing conditions on Ni-NTA agarose (Qiagen). The purified proteins were used for rat immunization in an in-house animal facility at the Charles University.
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Microbiology 2023Quote: ... under p32 promoter to the recombinant expression using PCR Cloning Kit (Qiagen, Germany). The recombinant plasmids were named as pMG36e:nisA (nisA) ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Nickel sepharose according to the manufacturer’s instructions (QIAGEN). The purified recombinant protein was dialyzed overnight against dialysis buffer (20 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... The recombinant TDP-43 proteins were purified over Ni-NTA agarose beads (Qiagen) and eluted using 50 mM HEPES (pH 7.5) ...