Labshake search
Citations for Qiagen :
301 - 350 of 4495 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... PCR products were column-purified (Qiaquick PCR Purification kit, Qiagen, Valencia, CA) and assembled using the HiFi reaction kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... the PCR products were purified with a QIAquick PCR purification kit (Qiagen) and then directly sequenced with primers ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were isolated by using the Qiaquick PCR cleanup kit (Qiagen) and then sequenced directly using the lacZ_MIDREV2 primer (Table S7 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and performed PCR reactions with the Type-it microsatellite PCR kit (Qiagen) (see Supplementary Methods for additional information on PCR procedure).
-
bioRxiv - Immunology 2019Quote: ... PCR products were purified using a QIAquick PCR purification kit (Qiagen, UK) according to manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction was cleaned with the QIAquick PCR Purification Kit (QIAGEN), and cloned as a ∼110-bp SapI-XbaI fragment into pPuro2-hU6-gRNA-CBh-Cas9 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The resulting PCR amplicons were purified using MinElute PCR purification kit (Qiagen). Sequencing library was constructed from 100 ng DNA and approximately 50-100K 300-base read pairs were generated on an Illumina MiSeq platform ...
-
bioRxiv - Developmental Biology 2020Quote: ... Q-PCR were performed using QuantiNova SYBR Green PCR Kit (Qiagen, 208054). Detection was performed using Rotor-Gene Q Real-time PCR cycler (Qiagen).
-
bioRxiv - Plant Biology 2020Quote: ... PCR products were purified with the Qiaquick PCR Purification kit (Qiagen, Benelux) and sent for sequencing using the Sanger dideoxy sequencing technology (MACROGEN Inc. ...
-
bioRxiv - Immunology 2020Quote: ... Amplified DNA was PCR-purified using QIAquick PCR Purification Kit (Qiagen 28106) following the manufacturer’s protocol and prepared for Sanger sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific 4337457) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Digestions and PCRs were purified using the QIAquick PCR Purification Kit (Qiagen).
-
bioRxiv - Synthetic Biology 2020Quote: ... Digestions and PCRs were purified using the QIAquick PCR Purification Kit (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN, 28106) and sent for Sanger sequencing to the Keck Sequencing Facility (Yale University ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The PCR product was cleaned using the PCR purification kit from Qiagen, digested with NdeI/BamHI ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Digestions and PCRs were purified using the QIAquick PCR Purification Kit (Qiagen).
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using the QIAquick 96 PCR Purification Kit (Qiagen) following the manufacturer’s instructions and sequenced by Eurofin Genomics ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Digestions and PCRs were purified using the QIAquick PCR Purification Kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... PCR products were cleaned using QIAquick PCR purification kit (Qiagen, Germantown, MD) and sequence determined by Sanger sequencing (Macrogen USA ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were column purified using a PCR purification kit (Qiagen), cut by Pac1 and Pme1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR products were pooled and purified using the PCR purification kit (Qiagen). Multiplexed libraries were sequenced on Illumina HiSeq 2500 at the Sequencug platform of the University of Geneva to obtain 100 bp single-end reads ...
-
bioRxiv - Synthetic Biology 2020Quote: ... F15 was PCR amplified and purified using QIAquick PCR purification Kit (Qiagen). Following elution with MiliQ water ...
-
bioRxiv - Genomics 2019Quote: ... After purification of the PCR products (MinElute PCR Purification Kit, QIAGEN, USA), the concentration of the DNA library was measured through the Qubit assay (Life Technology ...
-
bioRxiv - Biochemistry 2019Quote: The PCR reaction was purified using the QIAquick PCR Purification Kit (Qiagen) after digestion of the template plasmid with 20 U Dpn I (NEB ...
-
bioRxiv - Biophysics 2019Quote: ... PCR reactions were subsequently purified using QIAquick PCR purification spin columns (Qiagen) (Supplementary Fig ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were then purified with the QIAquick PCR Purification Kit (Qiagen) and their concentrations were quantified with Qubit (dsDNA High Sensitivity Assay) ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR products were purified with a MinElute PCR purification kit (Qiagen) and cloned into qCR2.1 Vector from TA Cloning Kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR reactions were performed using the OneStep RT-PCR Kit (Qiagen) with only very few differences compared to the detection assay ...
-
bioRxiv - Genomics 2021Quote: ... PCR fragments were purified using the QIA Quick PCR Purification Kit (Qiagen) and then ligated in the PCRTM2.1-TOPO using the TOPO TA Cloning Kit (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative PCR was performed using a QuantiTect SYBR Green PCR kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... the PCR amplicons were purified using QIAGEN PCR purification kit (QIAGEN, Germany) as per the manufacturer’s instructions and subjected to Sanger sequencing using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesised and PCR amplified with Onestep RT-PCR kit (Qiagen). Ighv alleles were amplified using a common variable region primer msVHE (5’GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR product was purified using QIAquick PCR Purification Kit (Qiagen Inc.) and incubated at 72°C for 10 min in a reaction mixture containing 200 μM of dATP ...
-
bioRxiv - Genomics 2020Quote: ... Labeled PCR product was purified with a QIAquick PCR Purification Kit (QIAGEN) and 50ng was mixed with hybridization buffer ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were then purified using the QIAquick PCR Purification Kit (Qiagen), eluted in TE buffer at pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using QiaQuick PCR purification kit (Qiagen, Hilden, Germany) and purified PCR products were sequenced using the amplification primers (JH0780 ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were purified with the QIA quick PCR purification kit (Qiagen), and both strands were sequenced on an ABI Automated Sequencers (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were purified using the QIAquick® PCR Purification Kit (Qiagen). Cycling conditions for the first PCR were as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitive PCR was performed using the QuantiFast SYBR Green PCR Kit (Qiagen) using primers for Hprt (fwd ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-PCR was performed by QuantiTect SYBR Green RT-PCR kit (Qiagen) using the following primer ...
-
bioRxiv - Genetics 2020Quote: ... Quantitative PCR was carried out using QuantiFast SYBR Green PCR Kit (Qiagen) for detecting products on a StepOnePlus Real-Time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... qRT-PCR was done using the QuantiTect SYBR Green PCR kit (Qiagen) on an QuantStudio 6 flex qPCR device (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2022Quote: ... PCR products were purified using a Qiagen QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were purified using QIAquick PCR purification columns (Qiagen, Cat #28106), loaded onto 20% TBE gels (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR purification was performed using the QIAquick PCR purification kit (Qiagen #28106). The mix of the three samples was sequenced on a MiSeq instrument (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... the PCR products were purified using QIAquick® PCR Purification Kit (Qiagen) and sent for Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: Nested RT-PCRs were performed using the OneStep RT-PCR kit (Qiagen). In each reaction ...
-
bioRxiv - Microbiology 2022Quote: ... This PCR product was purified using the QIAquick PCR purification kit (Qiagen) and then transformed into EF3030 or D39 using an standard transformation procedure (79) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR reactions were cleaned up using a QIAquick PCR cleanup kit (QIAGEN) and Sanger sequencing of PCR products using Ssal_tp53_seq_rev was performed by Eurofins genomics ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The amplified PCR fragments were purified using QIAquick PCR purification buffers (Qiagen) and RNeasy MinElute Cleanup columns (Qiagen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The amplified PCR fragments were purified using QIAquick PCR purification buffers (Qiagen) and RNeasy MinElute Cleanup columns (Qiagen ...