Labshake search
Citations for Qiagen :
301 - 350 of 6660 citations for Dengue Virus Serotype 2 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Protein Precipitation Solution (Qiagen) was added at 0.33x and mixed well ...
-
bioRxiv - Microbiology 2020Quote: ... Viral nucleic acids were then isolated using the Qiagen QIAamp MinElute Virus Spin Kit without the use of AW1 buffer or carrier RNA (Qiagen, Valencia, CA, USA). Random hexamers were used to prime cDNA synthesis (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in 384 well plates on an Applied Biosystems 7900HT Fast Real-Time PCR system using the QuantiTect Virus Kit (Qiagen, Redwood City, CA) and SARS-CoV-CDC RUO primers and probes (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were maintained in sphere-forming cultures for 2 weeks prior to RNA collection (RNAeasy Kit, Qiagen). TGFB1 was replenished when placing mOSE cells in sphere-forming conditions.
-
bioRxiv - Cell Biology 2019Quote: ... At least 2×102 cells were lysed and RNA was extracted with the RNAeasy Mini Kit (Qiagen) following manufacturer specifications ...
-
bioRxiv - Systems Biology 2020Quote: ... Cell pellets were transferred to 2 ml polypropylene tubes and disrupted twice using a TissueLyser II (Qiagen), adding the same volume of acid-washed glass beads (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: 2 x 106 cells were harvested and RNA was purified using Qiagen RNeasy Mini Kit (Qiagen, #74104) using manufacturer protocol ...
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 RNA from cell supernatant was extracted using the QIAamp viral RNA mini kit (Qiagen). A two-step qRT-PCR was used to detect viral RNA released in the cell supernatant ...
-
bioRxiv - Synthetic Biology 2022Quote: ... first the filter-harvested cells were resuspended in 2 mL RNAprotect Bacterial Reagent (Qiagen Catalog no. 76506), then pelleted in a centrifuge ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: Whole tissue protein was extracted by Qproteome Mammalian Protein Prep Kit (Qiagen, 37901) according to the manufacture’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protein were extracted using the AllPrep DNA/RNA/Protein kit (Qiagen, #47054). Sample concentrations were measured with Qubit high sensitivity dsDNA and RNA platform ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated by adding 100 μL of a protein precipitation solution (Qiagen). Samples were centrifuged for 5 min at 13000 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were lysed and recombinant proteins were purified under native conditions using the Ni-NTA Fast Start Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The cell lysate was clarified by centrifugation at 13,000 rpm and protein was purified using Ni- NTA superflow resin (Qiagen), according to the manufacturer’s recommendations for a centrifugation-based protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Headless HA stalk proteins were expressed in 293F cells and purified using nickel-nitrilotriacetic acid agarose (no. 1018244, Qiagen) in 5-ml polypropylene columns (no ...
-
bioRxiv - Microbiology 2019Quote: HeLa cells (2×106) were transfected with 100 pmol of validated siRNAs against all human ZDHHCs [42] (Qiagen) using interferrin transfection reagent (Polyplus) ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Genomics 2021Quote: Total RNA was collected from 2×106 CAR T cells with the RNEasy Plus Mini isolation kit (Qiagen). Library preparation and RNA-seq was performed by BGI America (Cambridge ...
-
bioRxiv - Biochemistry 2021Quote: ... brucei genomic DNA was isolated from ∼ 2 × 108 bloodstream form cells using a DNeasy Blood & Tissue Kit (Qiagen) using standard methods.
-
bioRxiv - Immunology 2021Quote: RNA of cells exposed to SARS-CoV-2 was isolated with the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturers protocol ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Systems Biology 2022Quote: ... Aliquots of 2 mL of cell cultures were submitted to DNA extraction using DNeasy Blood & Tissue kit (QIAGEN). DNA samples were quality checked and genotyped using PCR to confirm strains (Table S5) ...
-
bioRxiv - Microbiology 2023Quote: ... 150 μL of the aggregated or non-aggregated cells were then washed with 2 volumes of RNAprotect (Qiagen) to prevent RNA degradation ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from approximately 2 million SNU16 cells was extracted using the MagAttract HMW DNA Kit (Qiagen 67563) and prepared for long-read sequencing using a Ligation Sequencing Kit V14 (Oxford Nanopore Technologies SQK-LSK114 ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Biochemistry 2023Quote: ... brucei genomic DNA was isolated from ∼2 × 108 bloodstream form cells using a DNeasy Blood & Tissue Kit (Qiagen).
-
bioRxiv - Immunology 2024Quote: ... 2 × 104 cells were sorted in triplicate per sample and stored at −80°C in RLT buffer (Qiagen). RNA was isolated using the Qiagen RNeasy Micro Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... brucei genomic DNA was isolated from ∼ 2 × 107 bloodstream form cells using a DNeasy Blood & Tissue Kit (Qiagen) using standard methods.
-
bioRxiv - Neuroscience 2024Quote: RNA was extracted from SH-SY5Y and SK-N-BE(2) cells using the RNeasy mini kit (Qiagen) following the manufacturer’s protocol including the on-column DNA digestion step ...
-
bioRxiv - Genomics 2020Quote: ... Protein was precipitated by adding 200 µL of ice-cold Protein Precipitation Solution (Qiagen), gentle mixing and incubation on ice for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
bioRxiv - Neuroscience 2020Quote: ... Total protein was extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen #80004) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total protein was purified by the AllPrep DNA/RNA/Protein Mini Kit (Qiagen: # 80004). Corresponding protein expression levels in the cells of different groups were detected by western blot using the following antibodies ...
-
bioRxiv - Developmental Biology 2022Quote: ... 333µl Protein Precipitation Solution (Qiagen) was added and samples were vortexed vigorously for 20 seconds at high speed ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein Precipitation Solution (Qiagen #158910), DNA Hydration Solution (Qiagen #158914 ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acid was extracted from 200 μl of each sample using the QIAamp MiniElute™ Virus Spin Kit nucleic acid (for DNA and RNA) according to the manufacturer (QIAgen Canada, Toronto, ON, Canada). DNA samples were stored at −80°C and assayed in duplicate by qPCR ...
-
bioRxiv - Cell Biology 2022Quote: ... were performed on significantly altered proteins in CAVIN1-null cells using the “core analysis” function included in the Ingenuity Pathway Analysis (IPA) software (QIAGEN Bioinformatics ...
-
bioRxiv - Molecular Biology 2020Quote: RNA and protein were extracted from cell lines using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen, Valencia, CA, USA). Total RNA was also DNase treated using the TURBO DNA-free Kit (Applied Biosystems ...
-
bioRxiv - Biochemistry 2019Quote: Mutant Chinese hamster BiP proteins with an N-terminal His6-tag were purified as described before with modifications (Preissler et al, 2017b). Proteins were expressed in M15 Escherichia coli (E. coli) cells (Qiagen). The bacterial cultures were grown in LB medium supplemented with 100 µg/ml ampicillin and 50 µg/ml kanamycin at 37 ° C to an OD600nm of 0.8 and expression was induced with 1 mM IPTG ...
-
bioRxiv - Bioengineering 2021Quote: The dataset of differentially abundant proteins between groups were classified for cell compartment association with Ingenuity Pathway Analysis (IPA, Qiagen) and for matrisome categories using The Matrisome Project database,[28] ...
-
bioRxiv - Cancer Biology 2022Quote: ... 250,000 cells were lysed in RLT-plus buffer and RNA was purified with AllPrep DNA/RNA/Protein Mini Kit (#80004, Qiagen) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Gene expression of 84 heat shock genes in mock-infected or 229E-infected cells was analyzed using Human Heat Shock Proteins & Chaperones RT2 Profiler PCR array (Qiagen). Real-time PCR analyses were performed with specific primers ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... Protein was extracted 48 hours post transfection with All Prep RNA/Protein Kit (Qiagen, USA). Protein concentrations were determined by Lowry assay (Bio-Rad ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... protein extraction was performed using the Allprep RNA/Protein Kit (80404 Qiagen Inc., Hilden, Germany). Proteins (10–20 µg ...