Labshake search
Citations for Qiagen :
301 - 350 of 1218 citations for CCL24 Eotaxin 2 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Raw FASTQ reads were aligned to the GRCh38 human genome using CLC Genomics Workbench version 22.0.2 software (Qiagen, USA). Differential gene expression was determined using the built-in tool in CLC Genomics workbench ...
-
bioRxiv - Physiology 2024Quote: RNA was extracted from human tissue derived organoids and neutrophils using the RNeasy® Plus Mini Kit (Qiagen, #74104) with cDNA prepared using a SuperScript™ VILO™ cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA (200 ng) was used for quantitative PCR with the Human Cellular Senescence RT2 Profiler™ PCR Array (Qiagen) containing 84 key genes involved in the initiation and progression of the biological process causing cells to lose the ability to divide ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted from the cell pellets of human primary male and female PT cells using the RNAeasy Mini Kit (Qiagen). After quantifying RNA concentration in a Nanodrop instrument (Thermo) ...
-
bioRxiv - Cancer Biology 2019Quote: ... was isolated from human PanNET specimens or cells grown on 6-cm or 10-cm plates using RNeasy mini kit (Qiagen) containing gDNA eliminator spin columns ...
-
bioRxiv - Molecular Biology 2019Quote: Preliminary screening for the presence of serum exosomal miRNAs was determined using a miScript human miFinder PCR array (MIHS-001Z, Qiagen). RNA was converted to cDNA using miScript RT kit (218060) ...
-
bioRxiv - Plant Biology 2019Quote: ... three replicates of 25 to 30 pooled egg cells were used for total RNA extraction according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (Qiagen). In brief ...
-
bioRxiv - Genetics 2020Quote: ... Analyses of HTT CAG repeat size in both HttQ111 mice and in patient fibroblasts was performed by PCR using human-specific HTT primers and Taq PCR Core Kit with Q solution (Qiagen), as previously described (17 ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared cDNA was preamplified using the RT2 PreAMP Primer Mix for Human and Mouse PCR Array (Qiagen, PBH-181Z). cDNA was analyzed by RT-qPCR using a Qiagen RT2 profiler custom panel (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... Synthetized cDNA was subjected to a PCR array specific for the human antiviral response (RT² Profiler PCR array – PAHS-122Z, SA Biosciences, Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was used for human ISG15 and ISG56 and mouse genes including Gapdh as the housekeeping gene on the Rotor-Gene Q 5plex (Qiagen). RT-qPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Microbiology 2021Quote: ... mRNA-Seq FASTQ reads were mapped to the human reference genome (Homo sapiens v81; hg38) using default options on CLC Genomics Workbench 11 (Qiagen). Total gene reads (with at least 1 read count ...
-
bioRxiv - Genomics 2020Quote: RNA isolation for all the 248 human subjects were performed using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The isolated RNA was subjected to qPCR for determining viral load by Ct values ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from human fibroblasts as well as iNs from the same lines using the miRNeasy kit (Qiagen) followed by Universal cDNA synthesis kit (Fermentas) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 ng of genomic DNA derived from sorted neuronal and non-neuronal nuclei of a postmortem human ACC sample (Brain A) was used for bisulfite conversion (EpiTect Bisulfite Kit, Qiagen). For each sample ...
-
bioRxiv - Cancer Biology 2021Quote: RNA/DNA was isolated from the macro-dissected xenografts (injected/contralateral side, separately) and human GBM (AllPrep DNA/RNA Mini Kit, Qiagen). The ratio of human/mouse cells in the xenografts was estimated by species specific PCR (DNA ...
-
bioRxiv - Developmental Biology 2022Quote: RNA samples from freshly thawed human primary hepatocytes (SMC and AQL) or from PSC-hepatocytes were prepared with RNeasy plus micro kit (Qiagen), and 10-20 ng total RNA samples were used for constructing stranded RNA libraries with Swift RNA-seq library preparation kit and sequenced with an Illumina HiSeq 2500 sequencer with 50 base single end reads.
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... both hNS1 and hNP cells were transfected with human miRNA-mimics (double stranded RNAs that mimic mature endogenous miRNAs, Procured from Qiagen) of the mentioned ...
-
bioRxiv - Bioengineering 2020Quote: Total DNA samples were obtained from human skin biopsy samples (XX, caucasian, 79 yr) using the QIAamp DNA Mini Kit (Qiagen) and applied to the human Illumina Infinium EPIC 850K chip ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-seq FASTQ data were processed and mapped to the human reference genome (hg38) with the CLC Genomics Workbench 20 (Qiagen). Differential gene expression was analyzed with the DESeq2 package in R (Drummond et al. ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN). After pelleting by centrifugation for 5 minutes at 5,000 x g ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Biochemistry 2022Quote: ... high molecular weight genomic DNA (gDNA) was purified from human primary T cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Gene expression of 84 heat shock genes in mock-infected or 229E-infected cells was analyzed using Human Heat Shock Proteins & Chaperones RT2 Profiler PCR array (Qiagen). Real-time PCR analyses were performed with specific primers ...