Labshake search
Citations for Qiagen :
301 - 350 of 3606 citations for 7 Chloro 3 4 2 hydroxyethyl 1 piperazinyl 1 2 propoxyethyl pyrido 3 4 b pyrazin 2 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: RNA was extracted from 14-day-old wild-type and acinus-2 pinin-1 seedlings using RNeasy mini kit (Qiagen) and treated with TURBO DNA-free Kit (Ambion ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... The retrieved tissue mROIs were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... per condition or genotype were homogenized in 2-ml Eppendorf tubes containing lysis buffer with 1% beta-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless steel beads (Qiagen #69989) ...
-
bioRxiv - Neuroscience 2020Quote: ... GluA1 or GluA2Q (pIRES2-mCherry or pIRES2-EGFP) and CNIH2 (pRK5 or pBOS) plasmids were transfected at a 1:2 ratio using Effectene (QIAGEN) into adherent HEK293T cells (ATCC ...
-
bioRxiv - Genomics 2019Quote: ... 2D monolayers were lysed in RLT buffer supplemented with 1% 2-Mercaptoethanol before RNA purification using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions and including the on-column DNase digestion step ...
-
bioRxiv - Synthetic Biology 2020Quote: Cells were grown in triplicates on JMM 40 mM glycine and 40 mM pyruvate till mid-log phase and 1-2 mL of cultures were harvested and stabilized directly by RNA Protect Bacteria Kit (Qiagen). Cells were then lysed using lysozyme and beating with glass beads in a Retschmill (MM200 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue microregions were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Immunology 2021Quote: ... A total of 1-2 μg of RNA was used to synthesize the first single-strand cDNA using QuantiTect Reverse Transcription kit (Qiagen). For RT-PCR amplification ...
-
bioRxiv - Genomics 2021Quote: We began the assembly by first mapping long reads to the S288c reference genome (version R64-2-1) using CLC Genomics Workbench (Qiagen)(Fig ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from individual pools of 1×104 to 2×104 double-sorted SLAM cells using an RNEasy Micro kit (Qiagen). RNA was quantified and quality checked using an Agilent Bioanalyzer 2100 (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50uL of the dounce homogenized sample was labelled as “input” and added to 350uL RLT buffer with 1% 2-mercaptoethanol (Qiagen), followed by RNA extraction ...
-
bioRxiv - Biochemistry 2021Quote: ... and early stationary phase (OD = 1.0-1.3).1 mL sample of each culture was directly transferred to 2 mL RNAprotect cell reagent (Qiagen, Hilden, Germany). The samples were vortexed 5 sec ...
-
bioRxiv - Genomics 2022Quote: ... RNA (3 replicates each of V or E2 treated samples from donor 1 and donor 2) was DNAse treated and cleaned up using the RNeasy Mini kit (Qiagen) or the RNA Clean and Concentrator 5 kit (Zymo ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from 1-2*106 sorted naïve (CD25− CD44lowCD62high) or effector (CD25− CD44highCD62low) CD4+ T-cells using RNeasy Mini Kit (Qiagen Inc.) as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Neuroscience 2024Quote: ... DRG and paw skin RNA was extracted using a RLT buffer:2-mercapto ethanol mixture in a 100:1 ratio/RNeasy (Qiagen) RNA mini kit according to the manufacturer’s instructions and spinal cord and spleen RNA was extracted using TRizol (Invitrogen)/RNeasy RNA mini kit ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were directly lysed in the well using 350 µL of lysing solution (1% 2-mercaptoethanol in Buffer RLT; RNeasy Mini Kit, 74106, Qiagen) by pipetting over the well ...
-
bioRxiv - Cell Biology 2022Quote: ... The cleared lysate was then incubated with 3 mL of 1:1 Ni-NTA agarose slurry (Qiagen, product number 30210) for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... homogenized in 1 ml PBS by bead beating (3 mm steel ball, 25 Hz for 1 min in a TissueLyser (Qiagen)) ...
-
bioRxiv - Genetics 2020Quote: ... approximately 30 seeds per genotype were placed in a 2 mL Eppendorf Safe Lock tube along with one stainless steel bead (Qiagen Cat. No. 69989), frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Neuroscience 2023Quote: ... the tissue was ground using a tissue lyser (Qiagen, 3 min at 300 s-1) in 200 µL 500 mM Tris pH 9 by adding a metal ball (diameter 5 mm) ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and ground for 2 min using a TissueLyser (Qiagen). DNA extraction was performed using a 96-well column based kit ...
-
bioRxiv - Genomics 2019Quote: ... and BS (2) EpiTect Bisulfite Kit (QIAGEN, Hilden, Germany) respectively according to the manufacturers’ recommendations ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) are added to one volume of bacterial culture ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
-
rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencingbioRxiv - Microbiology 2019Quote: ... IJs were crushed by three cycles of mechanical grinding (2 minutes at 30 Hz followed by 1 minute without agitation) in a TissueLyser II apparatus (Qiagen, France). We added 2 µL of Ready-Lyse Lysozyme Solution (Epi-centre ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Cell Biology 2019Quote: ... MCMBP depleted cells using siRNA and MCMBP-KO (clone #1 and #2) cells was isolated using RNeasy Mini Kit (Qiagen, 74104). The cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplicons were separated on a 1-2% agarose gel and appropriate bands were excised and isolated using a gel extraction kit (Qiagen, USA). These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... log-phase cells in the range of 1–2 × 108 cells using the Qiagen DNeasy® Blood and Tissue kit (Qiagen). We resuspended the genomic DNA in 10 mM Tris-HCl pH 8.5 and stored it at 4° until submission to the McDonnell Genome Institute at Washington University in St ...
-
bioRxiv - Cancer Biology 2023Quote: DNA was extracted from NCI-PC35-1 and NCI-PC35-2 organoids using an AllPrep DNA/RNA Mini Kit (Qiagen 80204) according to the manufacturer’s protocol for animal cells ...
-
bioRxiv - Biophysics 2023Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA 27 gene was used as the internal control for normalization ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... were homogenised in QIAzol reagent (1 mL) in a 2 mL safe lock tube with stainless steel beads using a TissueLyser II homogeniser (Qiagen, UK) at 30 Hz until fully homogenised (1-2 min) ...
-
bioRxiv - Cell Biology 2023Quote: ... snap frozen samples were homogenized in an Eppendorf tube using a 3-mm Tungsten carbide beads and TissueLyser II system (Qiagen; 4 min at 30 Hz). RNA isolation steps were followed as mentioned above in this section ...
-
bioRxiv - Pathology 2020Quote: ... diffracting crystals of P1_102-157 were obtained at 4°C from condition 7 of the Classic kit (Qiagen) containing 0.1 M tri-Sodium citrate pH 5,6 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-month-old zebrafish (1 fish/sample) using the RNeasy Mini Kit (Cat. No. 74104; Qiagen) per the manufacturer’s instructions ...