Labshake search
Citations for Qiagen :
301 - 350 of 3876 citations for 6 methyl 5 6 7 8 tetrahydro 1 3 dioxolo 4 5 g isoquinolin 6 iumchloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... RNA and protein were extracted 6 days post-transduction using the AllPrep RNA/Protein kit (Cat: 80204, Qiagen, Germantown, MD USA). RNA was converted to cDNA using SuperScript IV cDNA Synthesis Kit (Cat ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were then harvested by centrifugation (5 min, 10,000 × g) and immediately suspended in 1 mL bacterial RNA protect (Qiagen, Germantown, MD), followed by 5 min incubation at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Soil samples (8 g) preserved in LifeGuard solution (Qiagen) were thawed on ice and centrifuged at 2,500 x g for 5 minutes to collect the soil at the bottom of the tubes ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427) was used to transfect 500 ng of the indicated eGFP plasmid ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were reverse transfected with 5 pmol of each siRNA (QIAGEN) using lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One million cells per well were seeded in 6 well plates in 2 mL growth medium the day before transfection and transfected with PolyFect (Qiagen, Düsseldorf, DE) using the manufacturers protocol (changing the medium to growth medium without hygromycin B and puromycin prior to transfection) ...
-
bioRxiv - Plant Biology 2020Quote: Genomic DNA was isolated from all Arabidopsis genotypes at 6 and 9 days after inoculation using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2022Quote: ... samples were homogenized using a tissue homogenizer (Brinkmann Instruments, Model PT 10/35, 110 Volts, 6 Amps, 60 Hz) for spleen and thymus while RLT (Qiagen, Hilden, Germany) and hand homogenization was used to isolate BM ...
-
bioRxiv - Cell Biology 2020Quote: ... All HA positive clones were amplified in a 6 well plate and genomic DNA isolated using Qiagen DNAeasy blood and tissue kit as per manufactures instructions (Qiagen, Germantown, MD) (Cat #69504) ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from pooled ipsilateral lumbar (L4-6) DRGs from one rat using the Qiagen RNeasy Mini Prep Kit (Qiagen, Valencia, CA) with on-column DNase digestion (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... UNC-6 and UNC-40 constructs of various lengths were purified first with Ni-NTA metal-affinity chromatography (QIAGEN, cat. no. 30210) from conditioned media ...
-
bioRxiv - Physiology 2023Quote: Total RNA and miRNA was extracted from liver and distal intestine (n = 6 per condition) using a miRNeasy Tissue/Cells Advanced Mini Kit (Qiagen, Hilden, Germany) following the protocol provided by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... The MLB and MLBE tubes were then subjected to bead-beating for 6 min using the TissueLyser Lt (Qiagen®, Hilden, Germany), with the instrument set at 50 Hz ...
-
bioRxiv - Physiology 2023Quote: ... proximal intestine and distal intestine (n = 6 per sampling day and diet) according to the miRNeasy Tissue/Cells Advanced Mini Kit protocol (Qiagen, Hilden, Germany). RNA was treated with the Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... which were cultivated on a rotary shaker at 37° for 6 h before plasmid isolation using a Midi Kit (Qiagen, Hilden, Germany). The obtained plasmid libraries were subsequently used for electroporation of C ...
-
bioRxiv - Developmental Biology 2023Quote: ... E17 and P0 (n=6 embryos per sex and time point) using the Qiagen miRNeasy mini kit (CatNo. 217004; Qiagen; Hilden, Germany). 500 ng of total RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Key genes involved in the regulation and enzymatic pathways of fatty liver were simultaneously assayed with the RT2 Profiler PCR Array Human Fatty Liver (PAHS-157ZC-6) (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions and analyzed with the Data Analysis Center (QIAGEN Hilden ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Cell Biology 2019Quote: ... incubated with Trizol for 5 min at 4°C and homogenized using TissuLyserTM (Qiagen) for 5 min at 50 Hz ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... total RNA and genomic DNA was extracted from flash frozen testes of a subsample of males 6 to 10 days following injection with the dsRNA using a Qiagen Allprep DNA/RNA Mini Kit (Qiagen, Venlo, The Netherlands). Expression levels for Dnmt1 was analyzed using qRT-PCR as described above.
-
bioRxiv - Plant Biology 2020Quote: ... and whole seedling shoot of 8-day-old seedling (Figure 2C and Supplemental Figure 6) were used to extract RNA using the RNeasy® Mini kit (Qiagen, Hilden, Germany) followed by DNase I (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were seeded in 6-well plates 24 h prior to isolation of total RNA using a RNeasy Mini Kit (QIAGEN, Santa Clara, CA). mRNA levels for EMT-related genes were determined using the validated primer sets (SA Biosciences Corporation ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were harvested (1×106) by centrifugation (200 x g for 5 min at 25°C. Whole RNA was isolated using the Qiagen RNeasy kit (Qiagen) according to the manufacturer’s description ...
-
bioRxiv - Cell Biology 2023Quote: ... Cleared lysate was briefly incubated (approximately 5 min) with 3 ml Ni-NTA Agarose (QIAGEN) before flow-through was collected ...
-
bioRxiv - Cell Biology 2023Quote: ... siCASK #5 (Qiagen cat# SI02223368 ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was stopped using 15mM EDTA followed by incubation at 65°C for 5-7 min and purification on RNAeasy column (Qiagen). The purified RNA samples were processed for preparations of cDNA libraries using the TruSeq Stranded Total RNA Ribo-Zero H/M/R (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... 350 µL of NucleoSpin RNA extraction buffer along with 4-5 ceramic beads (Qiagen 13113) were added 14into the tube ...
-
bioRxiv - Genomics 2022Quote: ... The reactions were incubated for 15 min at 60 °C and then terminated by adding 1 μl 5 M NaOH to degrade RNA and heating at 95 °C for 5 min followed by neutralization with 1 μl 5 M HCl and one round of MinElute column clean-up (Qiagen). The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was stopped by adding 2.5 uL of 0.5M EDTA pH 8 and transposed DNA was purified using Qiagen MiniElute PCR purification kit (Qiagen). Purified DNA was amplified using the following condition ...
-
bioRxiv - Microbiology 2020Quote: DNA for metagenomic sequencing was extracted from ~7 g sediment (~0.7 g sediment in 10 individual lysis tubes) using PowerSoil DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL water and 5 μL 2x QuantiFast® SYBR® Green PCR Master Mix (Qiagen). Technical duplicates of this reaction mix were then analyzed on a Corbett Rotor-Gene 6000 real-time PCR cycler ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µM of forward and reverse oligos were heated for one minute at 100°C with 5 mM MgCl2 and 7 mM Tris-Cl (i.e. Qiagen Elution Buffer) and annealed by slowly cooling to room temperature.
-
bioRxiv - Immunology 2019Quote: ... the 250 genes comprising the signature of time since exposure to an active TB case (6 months vs. baseline) were analyzed using canonical pathway analysis with QIAGEN’s Ingenuity® Pathway Analysis platform (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity). To compare transcriptional modules that were concordantly or discordantly regulated between mice ...
-
bioRxiv - Cell Biology 2022Quote: ... After 72 h cells were passaged onto new 6-well plates and culturing continued for an additional 72 h after which cells were harvested in Buffer RLT (Qiagen; for RNA-sequencing, RT-qPCR) or used for cell culture experiments.