Labshake search
Citations for Qiagen :
301 - 350 of 1399 citations for 2 p sec Butylphenyl propionic Acid d3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Genetics 2024Quote: The organs of Corti of postnatal day (P)4 mice were dissected and stored at -20°C in RNAprotect Tissue Reagent (RNAlater®) (QIAGEN, cat. no. 76106). Total RNA was extracted using the SPLIT RNA extraction kit (Lexogen ...
-
bioRxiv - Developmental Biology 2020Quote: Nucleic acid material remaining in ECM preparations was isolated using a DNeasy Blood & Tissue Kit (Qiagen, Germany). The amount of DNA was quantified using Qubit Fluorometric Quantification.
-
bioRxiv - Bioengineering 2021Quote: The soluble fraction of the cell lysate was mixed with Ni2+-nitrilotriacetic acid agarose beads (Qiagen, USA), and the His6-tagged recombinant proteins were purified by immobilized metal affinity chromatography (IMAC ...
-
Structural Basis for SARS-CoV-2 Envelope Protein in Recognition of Human Cell Junction Protein PALS1bioRxiv - Biochemistry 2021Quote: ... the supernatant was collected for affinity purification by nickel-nitrilotriacetic acid affinity chromatography (Ni-NTA, Superflow, Qiagen). The eluate was concentrated and buffer exchanged for tag removal by incubation with TEV protease overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleic acid was extracted from cell culture media manually using a QIAamp Viral RNA Mini Kit (QIAGEN) or using NucliSENS easyMAG or EMAG platforms (both BioMérieux) ...
-
bioRxiv - Microbiology 2021Quote: RNA was purified by acid phenol-chloroform extraction and column purified (RNeasy mini kit QIAGEN REF 74104) from HFFs grown in media with or without Pan and/or infected with wild-type RH parasites (grown in regular or Pan-depleted media) ...
-
bioRxiv - Microbiology 2020Quote: ... using the MagAttract 96 cador Pathogen Kit in a BioSprint 96 nucleic acid extractor (Qiagen, Hilden, Germany), according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid extractions were performed by combining equal amounts of Lysis Buffer RLT (Qiagen, Germantown, MD, USA) with supernatant from clinical samples (swabs ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid extractions were performed by combining equal amounts of Lysis Buffer RLT (Qiagen, Germantown, MD, USA) with supernatant from clinical samples (swabs ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acids were extracted from supernatants and pellets using the QIAamp Viral RNA Mini Kit (52906, Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... https://www.beiresources.org/).Protein was purified using gravity flow purification with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen, Germany) and concentrated and buffer exchanged in Amicon centrifugal units (EMD Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: The MS2 RNA was purified from the phage particles using QIAamp Circulating Nucleic Acid Kit (Qiagen, Germany) accordingly to the manufacturer’s protocol and stored at −80°C.
-
bioRxiv - Molecular Biology 2021Quote: ... The MBP eluate was then incubated with pre-equilibrated nickel-nitriloacetic acid resin (Ni-NTA agarose, Qiagen) for 60 mins in the presence of 20 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: Locked Nucleic Acids (LNA) and miRNA mimics and scrambled LNA/mimic (negative control) was purchased from Qiagen and MOLM13 cells were transfected with either LONZA nucleofector devise (program X-001 ...
-
Stem cell-derived macrophages as a new platform for studying host-pathogen interactions in livestockbioRxiv - Immunology 2021Quote: ... 24 and 48 hours and nucleic acid extracted using Qiamp viral RNA mini extraction kit (Qiagen, #52904). Viral DNA levels were quantified by qPCR using primers and probe that detect the ASFV VP72 gene52 with the Quantifast Pathogen PCR kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from brain regions was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Microbiology 2021Quote: ... and supernatants were collected for affinity purification over pre-equilibrated nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) columns ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 and 0.1 μg) were allowed to bind 30 μl of nickel-nitrilotriacetic acid-agarose beads (QIAGEN) for 1 hour after which unbound decoy was removed by washing with PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... The subsequent isolation of nucleic acids was performed using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... Nucleic acid was extracted from the supernatant using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions with modifications ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids (both RNA and DNA) were extracted with the QIAamp Viral RNA Minikit (Qiagen; CA).
-
bioRxiv - Developmental Biology 2023Quote: ... DNA from brain regions was extracted using an automated nucleic acid extraction platform called QIAcube HT (Qiagen) with a column-based extraction kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The cleared lysate was then mixed with nickel-nitrilotriacetic acid (Ni-NTA)-agarose beads (QIAGEN, Hilden, Germany) or glutathione (GSH ...
-
bioRxiv - Cancer Biology 2023Quote: ... The diluted plasma was recovered and processed for cfDNA isolation by QIAmp Circulating Nucleic Acid kit (Qiagen) [16].
-
bioRxiv - Microbiology 2023Quote: ... and nuclease treated prior to viral nucleic acid extraction with the QIAamp viral RNA mini kit (Qiagen) (Chong et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C) and the supernatant was loaded onto a Ni-nitrilotriacetic acid (NTA) column (Qiagen, Hilden, Germany). After a washing step (6 M urea ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Biophysics 2020Quote: ... proteins were expressed in Escherichia coli strain BL21 (DE3) and purified via nickel-nitrilotriacetic acid affinity chromatography (Qiagen) followed by ion exchange chromatography on an Äkta system (GE Healthcare) ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acids were extracted using QIAamp 96 virus Qiacube HT kit on QIAxtractor Automated extraction (Qiagen, US) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Nucleic acids were isolated via chloroform extraction and RNA was isolated with the Qiagen RNEasy Mini (Qiagen #74104) including on-column DNase I digestion ...
-
bioRxiv - Plant Biology 2020Quote: ... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted from 140 ul of sample fluid using the QIAamp RNA Viral kit (Qiagen) and eluted with 30 ul of DEPC-treated water ...