Labshake search
Citations for Qiagen :
3301 - 3350 of 10000+ citations for Rat Palmitoyl Protein Thioesterase 1 PPT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... then purified using QIAquick PCR purification kit (Qiagen). Amplicons were sequenced by Sanger sequencing using Exon2seqRev (CCCGCAATTACAACATGCTAG ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and RNeasy MinElute Cleanup Kit (Qiagen, Hilden, Germany). Strand-specific libraries were prepared using the NEBNext mRNA Library Prep Reagent Set for Illumina ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted using RNAeasy kit (Qiagen). The extraction was done from a pool of 48hpf larvae ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then transferred a RNeasy Mini Kit (Qiagen, ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was extracted using mRNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted using mRNeasy kit (Qiagen) according to the manufacturer’s instructions and concentration was determined with the Nanodrop (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The RNeasy Plus Mini Kit (QIAGEN, Germantown, MD) was used to extract total RNA and cDNA was generated with the Superscript III kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was extracted (RNeasy Micro Kit, QIAGEN), and cDNA synthesis was performed using random primers (iScript Select cDNA Synthesis Kit ...
-
bioRxiv - Microbiology 2021Quote: ... then sodium bisulfite-converted (EpiTect Bisulfite kit, Qiagen). The 5’LTR or the rev regions were amplified by (semi)nested PCR (primer sequences are available upon request) ...
-
bioRxiv - Genomics 2021Quote: ... for Gomphillus and DNeasy Plant Mini Kit (Qiagen) for the rest of the samples ...
-
bioRxiv - Immunology 2021Quote: ... 51 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Genomics 2019Quote: ... purified with a QIAquick Gel Extraction kit (Qiagen) and sequenced in both directions with the original set of primers on a 3730XL DNA Analyzer (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and purified by QIAquick Gel Extraction Kit (Qiagen). Libraries were sequenced on HiSeq 2500 instrument.
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using the RNeasy kit (QIAGEN) and 500 ng of each RNA sample was used to synthesise cDNA using Superscript III reverse transcriptase according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... RNeasy Protect Bacteria Mini Kit (Qiagen, Hilden, Germany) was used according to the supplier’s protocol for enzymatic lysis and proteinase K digestion of bacteria ...
-
bioRxiv - Synthetic Biology 2021Quote: ... purified using the QIAquick PCR Purification Kit (Qiagen) and eluted in 80 µL H2O ...
-
bioRxiv - Microbiology 2021Quote: ... and QIAseq™ Library Quant Assay Kit (Qiagen). Then ...
-
bioRxiv - Evolutionary Biology 2020Quote: QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden) was used for the total genomic DNA extraction and purification from fecal samples of C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the QIAamp DNA Mini Kit (Qiagen, Germany). The DNA samples consisted of two samples from H ...
-
bioRxiv - Neuroscience 2020Quote: ... After purification using RNeasy MinElute Cleanup Kit (Qiagen), 300 pg of mFmn2-GFP capped RNA was co-injected with MO SB Fmn2 morpholino per embryo.
-
bioRxiv - Microbiology 2021Quote: ... and gel purified (QIAquick Gel Extraction Kit, Qiagen). Libraries were then quantified and sequenced with a 600 cycle MiSeq Reagent Kit (270×270 ...
-
bioRxiv - Microbiology 2021Quote: ... and gel purified (QIAquick Gel Extraction Kit; Qiagen). Libraries were then quantified (KAPA Library Quantification Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was extracted using the RNeasy kit (QIAGEN) and was subsequently treated with DNAse to remove genomic DNA (TURBO DNA-free kit ...
-
bioRxiv - Microbiology 2020Quote: ... microsporus using an RNeasy Plant Mini Kit (Qiagen) and sent to Novogene for library preparation and Illumina sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was isolated using the RNAeasy kit (Qiagen) and gene expression quantified by real-time PCR with primers listed in Supplementary Table 1.
-
bioRxiv - Cancer Biology 2022Quote: ... RNA was extracted with the RNeasy kit (Qiagen), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: RNA was extracted using the RNeasy kit (Qiagen) and gene expressiong measured by quantitative RT-PCR ...
-
bioRxiv - Bioengineering 2019Quote: ... purified using RNeasy mini kit (Qiagen, Germantown, MD), and genomic DNA was digested using Optizyme™ recombinant DNase-I digestion kit (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... Purified plasmid (Plasmid Plus Midi Kit, QIAGEN, Germany) was mixed with selection plasmid pCoBlast (1:10 ...
-
bioRxiv - Neuroscience 2021Quote: ... and purified using an RNeasy mini kit (Qiagen). Injection solutions were prepared with a final concentration of 300ng/µl nCas9n mRNA and 10ng/µl sgrNA in nuclease free water and 0.05% (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... and RNeasy Micro kit (74106, Qiagen, Valencia, CA) with DNase digestion steps according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... aNSCs and TACs using the miRNeasy kit (Qiagen). cDNA was synthesized using the Exiqon miRCURY LNA Universal RT microRNA kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was extracted using the RNeasy kit (Qiagen) with DNA removed with RNase-Free DNase (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purified using the RNAeasy mini kit (Qiagen). Agilent High Sensitivity RNA Screentape (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... using RNeasy®Microarray tissue kit (#73304 Qiagen) and treated with Turbo DNA-free kit (#AM1907 Ambion) ...
-
bioRxiv - Neuroscience 2021Quote: ... and the QuantiTect SYBR Green PCR Kit (Qiagen). Sequences of the different primer pairs used for PCR amplification of mouse and rat TPH2 and SERT cDNAs are listed in Supplementary Table S1.
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen) and complementary DNA (cDNA ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated using the RNeasy Kit (Qiagen). RNA sequencing was performed by Novogene Corporation Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... RNase-free Reagents and Buffers kit from Qiagen. DNase treatment was applied to the purified RNA using Qiagen RNase-Free DNase Set (50 ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was extracted with the RNeasy kit (Qiagen) and reverse transcribed with GoScript Reverse Transcriptase with random primers (Promega) ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen). RNA-Seq libraries were constructed and sequenced following standard protocols (Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... The miRNeasy serum/plasma kit (Qiagen, Cat #217184) was used to isolate total RNA from EVs following the manufacturer’s protocol with minor adaptations ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted using the RNAeasy kit (Qiagen) and DNase treated with the RNase-Free DNase kit (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and using the miRNeasy Mini kit (Qiagen, # 217004), following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted with RNeasy Mini Kit (Qiagen) following supplier’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RNeasy Plus kit (Qiagen, Cat No. 74134) with column-based genomic DNA removal ...
-
bioRxiv - Cancer Biology 2020Quote: ... total RNA was extracted (Qiagen RNeasy Mini Kit) and quantified by spectroscopy (Nanodrop ND-8000 ...
-
bioRxiv - Cell Biology 2021Quote: ... or the RNeasy Mini Kit (Qiagen, Hilden, Germany). 5 samples of myoepithelial cells and 5 samples of s-SHIP GFP+ cap cells were submitted and subjected to quality analysis using a 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was isolated using RNeasy Mini Kit (Qiagen). Purified RNA was used to prepare cDNA using the GeneChip WT Plus kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA was prepared with RNAeasy kit (QIAGEN) and libraries were constructed using 600 ng of total RNA from each sample and the TruSeqV2 kit from Illumina (Illumina ...