Labshake search
Citations for Qiagen :
3151 - 3200 of 3581 citations for 6 Methyl 3 4 dihydro 2H pyrido 3 2 b 1 4 oxazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified bacterial lysates from a 1 l culture were bound to a 0.5 ml column of Ni-NTA resin (Qiagen) by gravity flow ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted by incubation with 6 ml of lysis buffer (50 mM Tris pH 8.0, 50 mM EDTA, 1% SDS, 0.1 mg/ml proteinase K (Qiagen, 19131)) at 55°C for 16 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... V2 and V3 amplicons were resolved in the 1% agarose gel and purified using the gel purification kit (Qiagen). Each cDNA was cloned into pDONR201 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA (gDNA) was extracted from J-Lat cells 10.6 and HIV-1 negative CD4+ T cells with the QIAcube (Qiagen), using the QiaAmp DNA mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Rainbow proviral HIV-1 DNA dPCR assay was performed on a QIAcuity Four digital PCR platform (Qiagen, Germany) with at least 500 ng (CD4+ T cell ...
-
bioRxiv - Immunology 2023Quote: ... and approximately 1 µg of isolated RNA was converted to cDNA using RT2 First Strand Kit (Qiagen, Hilden, Germany). cDNA was diluted (1:10 ...
-
bioRxiv - Systems Biology 2023Quote: ... Large fragments (200-400 bp) were extracted from a 1% agarose gel with QIAquick Gel Extraction Kit (Qiagen, Netherlands). The final library was sequenced as 85 bp long single-end reads on a NextSeq™ 550 (Illumina ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was diluted 3 times with buffer A (20 mM HEPES, pH 7.4, 200 mM NaCl, 1 mM Asp) and incubated with Ni-NTA resin (Qiagen) for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... culture medium was replaced with base medium 1 hour before transfection and cells were transfected with miRNA mimics (Qiagen), including hsa-let-7a-5p (UGAGGUAGUAGGUUGUAUAGUU) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The OsHV-1 µVar DNA was extracted from 200 µL of water using the QIAmp DNA mini Kit (QIAGEN). Quantitative PCR was performed with 5 µL of DNA as described 46.
-
bioRxiv - Developmental Biology 2023Quote: Blastocysts were washed with DPBS containing 1 mg/ml polyvinylpyrrolidone (PBS-PVP) and transferred into 50 μl droplets of 0.1% protease (Qiagen) to remove the zona pellucida ...
-
bioRxiv - Bioengineering 2023Quote: ... total RNA was extracted from about 1 × 106 cells from all groups using RNeasy Mini Kit (Qiagen, Valencia, CA), then using the random hexamer primer and M-MuLV reverse transcriptase kit (Fermentas ...
-
bioRxiv - Microbiology 2023Quote: ... The tissue pellets were resuspended in 1 ml of FSW using a tissue lyser (Tissue-Lyser II, Qiagen, Australia) and the resuspension was homogenized using sterile glass homogenizers for 30 s ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Immunology 2023Quote: The post-caval lobe of the lung was weighed and homogenized in 1 mL of PBS (pH 7.4) using a TissueLyser LT (Qiagen). RNA was extracted using TRIzol™ LS Reagent (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... After overnight proteinase K digestion in Lysis Buffer (BNG) and 1-hour treatment with RNAse A (Qiagen, MD,USA), plugs were washed 4 times in 1×Wash Buffer (BNG ...
-
bioRxiv - Genomics 2023Quote: ... 1×106 cells were harvested from each culture and DNA was extracted using QIAamp DNA mini Kit (QIAGEN 51304). STR analysis was performed with PowerPlex 21 System (Promega DC8902 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Complementary DNA (cDNA) was synthesized from 1 ug of RNA using the QuantiTect reverse transcription kit (Qiagen, catalog #205311) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and were then incubated with or without triton-x (1% v/v) and with or without Rnase-A (Qiagen #19101 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was used to synthesize cDNA using a QuantiNova Reverse Transcription kit (205410, Qiagen, UK). qPCR was performed using QuantiNova SYBR green (208052 ...
-
bioRxiv - Microbiology 2024Quote: ... DNA on the exterior of filtered capsids was digested for 1 h at 25°C with 20.3 units DNase (79254; Qiagen) supplemented with 10 mM MgCl2 ...
-
bioRxiv - Plant Biology 2024Quote: ... four leaf discs (1 cm in diameter) were snap frozen in liquid nitrogen and powdered using a TissueLyser (QIAGEN). Total proteins were extracted from the powder using 400 μL GTEN buffer (10% glycerol ...
-
bioRxiv - Physiology 2024Quote: ... RNA (1 μg, quantified via Nanodrop-2000 spectrophotometer) was transcribed to cDNA using the QuantiTect Reverse Transcription kit (QIAGEN) and stored at -20°C prior to analysis ...
-
bioRxiv - Plant Biology 2024Quote: ... and ground for 1 min at 30 Hz with the pre-cooled Retsch Mill (Tissue Lyser II, Retsch, Qiagen). For quantification of S ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized from 1 µg of total RNA using the RT2 First Strand Kit (Qiagen, Germantown, MD, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 MES or CP cells were harvested and RNA extraction was performed using Rneasy mini plus kit (Qiagen). 1 μg of total RNA was used for the construction of sequencing libraries and sequencing.
-
bioRxiv - Microbiology 2020Quote: ... We immediately transferred all swabs and film to a microcentrifuge tube with 1 mL lysis buffer and garnet homogenization beads (Qiagen NV ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µM A740003 or both BzATP and A740003 together (A740003 was pre incubated for 1 h before adding BzATP) 24 hours later RNA was extracted using the miRNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was extracted from 1 B6 and two Card19lxcn BMDMs derived from three independent mice using a DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: CIRCLE-seq libraries were prepared for each gRNA (IDT) using genomic DNA extracted from NHGRI-1 (DNA Blood & Tissue kit, Qiagen) following the described protocol [59] ...
-
bioRxiv - Microbiology 2020Quote: ... We sampled 1 ml of the clear phase for living planktonic cells and extracted DNA using DNeasy Blood & Tissue Kit (Qiagen). The cultures were also plated on SHIEH-agar plates with dilutions for cfu/ml -estimation and colony-PCR.
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The tissue was ground to a fine powder by adding 10-15 zirconia beads (1 mm diameter) and using a TissueLyser (Qiagen) for sunflower ligules ...
-
bioRxiv - Genomics 2020Quote: PCR amplicons verified by 1% agarose gel electrophoresis were purified from gel using Gel extraction kit (Qiagen GmbH, Hilden, Germany) and ligated into a pGEM-T easy cloning vector (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from cavin1a/1b DKO and WT zebrafish embryos (> 100 embryos randomly selected from 1 clutch) using the RNeasy Mini Kit (QIAGEN) and cDNA synthesis was performed using SuperscriptIII reverse transcriptase (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNA was isolated from 1×106 BMMCs that were untreated or treated with IgE receptor crosslinking using the RNeasy mini kit (Qiagen). RNA was treated with DNase I according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmids containing qPCR amplicon sequences were linearized by digestion with SmaI for 1 h and purified using the QIAquick PCR purification kit (Qiagen). Linearized plasmids were quantified using spectrophotometry ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse tissue disruption and homogenization was performed in RIPA buffer supplemented with 1:100 protease using Tissue Lyser LT (Qiagen), for 5 min at 50 Hz ...
-
bioRxiv - Genetics 2019Quote: ... The resulting products were then either treated with DpnI or purified from a 1% agarose gel with a QIAquick Gel Extraction Kit (Qiagen) and transformed into E.coli DH5α competent cells (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... viral DNA was either extracted using modified phenol/chloroform extraction routes (Figure 1, Route A-D) or QIAamp Viral RNA Mini Kit [22] (Qiagen) according manufacturer’s instructions (Figure 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pellet was treated with 20 μg lysostaphin (1 mg/ml) and RNA isolation was performed using the RNeasy Plus mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: RNA extraction from 1-10 x104 FACS-sorted microglia or iPS-derived microglia-like cells was performed on the QIAcube (Qiagen) using the RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: The decellularized Balb/c mouse pancreas scaffolds were washed in PBS and homogenized-lysed for 1 hr in Tissue homozilyser II (Qiagen). The ECM proteins were dissolved in lysis buffer containing Tris HCl 0.06M ...
-
bioRxiv - Immunology 2019Quote: ... mucosal scrapings and feces were homogenized in a 2 ml eppendorf containing 1 ml of DNA extraction buffer and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lysate was then centrifuged at 15 000 ×g and the supernatant was added to the 1 mL Ni-NTA resin (Qiagen). After washing with Buffer A supplied with 30 mM imidazole ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 1∼5 million PBMCs into 30ml of water with RNeasy Mini Kits (Qiagen, Valencia, CA). For unbiased repertoire analysis ...
-
bioRxiv - Genomics 2019Quote: ... We washed the pellets with 1 ml 70% ethanol and air dried before resuspending the libraries in EB buffer (Qiagen).