Labshake search
Citations for Qiagen :
3101 - 3150 of 6611 citations for SARS CoV 2 Spike Glycoprotein S1 His tag Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from human cells with an RNeasy Mini kit (Qiagen). Northern blot was performed as described previously (Tafforeau et al. ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from tissue or cells using RNeasy mini-kit (Qiagen), and cDNA was synthesized using iScript cDNA Synthesis kit (BioRad ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from the cells using RNeasy mini Kit (QIAGEN, Germany). The cDNA was synthesized using Χ iScript kit (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... and the living cells were harvested and extracted for genomic DNA (Qiagen kit). Primer-F TTCTCCAATGCGACGGGTGTG and Primer-R AGATAGATGCGGGCTTCCAAC were used to amplify the first exon of RHO ...
-
bioRxiv - Developmental Biology 2021Quote: S2 cells were transfected with Btz-WT or Btz-HD using Effectene (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from pelleted cells using column capture (Qiagen RNeasy Mini Kit) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was isolated from cells using an RNeasy Plus Mini kit (Qiagen Inc.) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen, for cells) or TRIzol (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: RNA was extracted from cells using the RNeasy Plus Mini Kit (QIAGEN: 74136). An aliquot of total RNA was reverse transcribed using an oligo (dT ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted from Nr5a1-GFP+ cells with the RNeasy Mini kit (Qiagen) to obtain a minimum of 260 ng of total RNA ...
-
bioRxiv - Microbiology 2020Quote: Total RNA from eukaryotic cells was isolated using the RNeasy mini kit (QIAGEN). RNA was transcribed using the iScript reverse transcriptase (BioRad ...
-
bioRxiv - Biochemistry 2021Quote: Messenger RNA was extracted from HEK293 cells using an RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and used as the template to synthesise complementary DNA (cDNA ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from 2,5 ·106 cells by RNeasy Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and (iii) fibroblast cell lines using the DNeasy Blood and Tissue Kit (QIAGEN) that included an RNAse A treatment step (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... and (iii) fibroblast cell lines using the DNeasy Blood and Tissue Kit (QIAGEN) that included an RNAse A treatment step (QIAGEN ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from cells using a RNeasy RNA extraction Kit (Qiagen, 74136) and quality checked using Nanodrop 1000 (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... cells were processed with the DNeasy Blood and Tissue kit (QIAGEN (Hilden, Germany) 69506) ...
-
bioRxiv - Genomics 2020Quote: ... Nematodes were lysed by addition of 600 µL of Cell Lysis Solution (Qiagen) and 20 µL of proteinase K (20 µg/µL ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of room temperature Stop solution (REPLI-g Single Cell Kit, Qiagen) was then added and the samples were vortexed and spun down ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli cells were isolated according to the QIAprep Spin Miniprep Kit protocol (Qiagen). A restriction reaction was then set up to linearize the plasmid DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA from 1E6 cells per replicate was isolated using RNeasy96 kit (Qiagen). External RNA Controls Consortium (ERCC ...
-
bioRxiv - Cell Biology 2020Quote: ... the corresponding BACs were transfected into U2OS cells using the Effectene kit (Qiagen) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA was extracted from tumor cells (Qiagen, DNeasy blood and tissue kit) for WES ...
-
bioRxiv - Biophysics 2021Quote: ... Isolated total RNA from WT and KO U2OS cells (QIAGEN RNeasy Mini Kit) reverse transcribed into cDNA (BIORAD iScript™ cDNA Synthesis Kit ...
-
bioRxiv - Microbiology 2021Quote: ... gDNA was extracted by resuspending pellets in 600 μL Cell Lysis Solution (QIAGEN) and incubating at 80°C for 5 min ...
-
bioRxiv - Immunology 2020Quote: Total RNA was isolated from cells using the RNeasy RNA extraction kit (Qiagen), and cDNA synthesis was performed using 1 μg of total RNA (iScript ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was isolated from cells with the RNeasy Mini Kit (Qiagen, #74106) and treated with RNase-free DNase according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... total RNA was prepared from cells by using an miRNeasy mini kit (Qiagen) and mature miR-122-5p ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was isolated from the sorted cells using RNeasy Extraction kit (Qiagen). Quality and quantity of the resulting RNA were assessed using a NanoDrop ND-2000 spectrophotometer (Thermo Scientific ...
-
Epigenetic alterations underlie airway macrophage differentiation and phenotype during lung fibrosisbioRxiv - Immunology 2020Quote: Nucleic acids were extracted from cells using the AllPrep Mini Kit (QIAGEN, Germany). DNA quality and quantity were assessed using Genomic DNA ScreenTape and TapeStation System (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... Genomic DNA was extracted from cells using the QIAamp DNA Mini Kit (QIAGEN), then the HLA-DRB1 ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was isolated from mouse B cells using the DNeasy kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... and 1,000 CFSE-negative cells were sorted into 10 μL TCL buffer (Qiagen) with 1% BME (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was extracted from specified cell types using Rneasy Mini Kits (QIAGEN), and polyA selected using Oligotex mRNA Mini Kits (QIAGEN) ...
-
bioRxiv - Cell Biology 2021Quote: ... gDNA from cell pellets was isolated using a QIAamp Blood Maxi Kit (Qiagen) and genome-integrated sgRNA sequences were amplified using the KAPA HiFi HotStart ReadyMix (Kapa Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: RNA from cells was isolated using the RNeasy Mini Kit (Qiagen, Manchester, UK). 500 ng of total RNA was reverse-transcribed using the SuperScript First-Strand cDNA synthesis kit (Life Technology ...
-
bioRxiv - Neuroscience 2022Quote: Cells were harvested using buffer RLT from the RNeasy mini kit (Qiagen 74104). The RNeasy mini kit was then used to extract RNA ...
-
bioRxiv - Neuroscience 2022Quote: ... S2R+ cells were transiently transfected using Effectene transfection reagent (Qiagen, Valencia CA, #301425) and induced 24 hours later with 0.5 mM copper sulfate ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli cells and positive colonies were collected using a Mini Prep kit (Qiagen) and sequenced using the U6 primer (Supplementary Table 1 ...
-
bioRxiv - Developmental Biology 2022Quote: Cells were lysed and RNA extracted according to the RNeasy Mini kit (Qiagen). The cDNA synthesis was performed using the SuperScript III First-Strand Synthesis SuperMix (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... total RNA was extracted from isolated cells using the RNeasy Mini kit (Qiagen). Complementary DNA was synthesized from the extracted RNA using TaqMan™ Reverse Transcription Reagents (Applied Biosystems™ ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from the cells using RNeasy Plus Micro Kit (Qiagen). The initial amplification step for all samples was done with the NuGEN Ovation RNA-Seq System v2 ...
-
bioRxiv - Cell Biology 2022Quote: mRNA was extracted from cells using RNeasy Plus Microkit (Qiagen; Cat. No. 74034) and cDNA was prepared using RT2 First Strand Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... was performed approximately 24 h after cell plating using Effectene Transfection Reagent (Qiagen) with 1 µg siRNA in 742 µL transfection mixture ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was isolated in triplicate from cells using RNeasy Kit (Qiagen cat #74106) and genomic DNA was cleared with DNaseI treatment ...
-
bioRxiv - Cancer Biology 2022Quote: Based on the amount of cells homogenized in the RLT buffer (79216, Qiagen), the total RNA was isolated using the RNeasy Mini Kit (74106 ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from cells using the RNAeasy RNA extraction kit (Qiagen), followed by cDNA synthesis using the iScript cDNA Synthesis kit (Bio-Rad ...
-
bioRxiv - Developmental Biology 2022Quote: ... and EYFP-high sorted cells with the RNeasy Mini Kit (Qiagen, Cat. 74106). Reverse transcription was performed with the PrimeScript High Fidelity RT-PCR Kit (Takara ...
-
bioRxiv - Cell Biology 2022Quote: Total mRNA was extracted from cell culture using the RNeasy Mini kit (Qiagen) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... 10 000 cells were directly sorted in 350 µL of RLT buffer (Qiagen), vigorously vortexed for disruption and spin down ...