Labshake search
Citations for Qiagen :
3101 - 3150 of 10000+ citations for Mouse ATP Synthase Coupling Factor 6 Mitochondrial ATP5J ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and expanded with REPLI midi Kit (Qiagen, 150043). SOD1 Exon 1 was expanded using 20 µM of forward (CTATAAAGTAGTCGCGGAGACGGGGTG ...
-
bioRxiv - Developmental Biology 2021Quote: ... treatment and purification with an RNEasy kit (Qiagen). Embryo trunks were sectioned at 16µm on a cryostat (Leica CM1900 ...
-
bioRxiv - Genomics 2019Quote: ... using the DNeasy Blood and Tissue Kit (Qiagen). To confirm that the tumours and germline DNA were derived from the same patient ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted using the RNeasy kit (Qiagen), RNA quality was checked with a Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... RNA was isolated using RNeasy FFPE Kit (Qiagen). Isolated RNA was resuspended in RNAse/DNAse free H2O (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was purified by a MinElute kit (QIAGEN) and resuspended in 40 μl of Elution Buffer ...
-
bioRxiv - Microbiology 2021Quote: The QIAamp DNA mini kit (Qiagen, Hilden, Germany) was used for DNA extraction from Sterivex® filters (EMD Millipore ...
-
bioRxiv - Immunology 2019Quote: ... and purified using RNeasy MinElute Cleanup Kit (Qiagen). Purity and integrity of RNA was assessed using a Bioanalyzer 2100 with a Eukaryote Total RNA Nano chip (Agilent Technologies).
-
bioRxiv - Immunology 2020Quote: RNA was prepared using RNeasy micro kit (Qiagen). RNA quantity and quality was assessed using a Nanodrop 1000 Spectrometer (Peqlab ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... columns or the QIAquick Gel Extraction kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... and RNA was isolated using RNeasy Kit (Qiagen) with on-column DNase I digestion ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The Multiplex PCR Kit (Qiagen GmbH, Hilden, Germany) was used for PCR and sequencing was performed with the BigDye Terminator v.3.1 ...
-
bioRxiv - Neuroscience 2019Quote: ... followed by the RNeasy MinElute Cleanup Kit (Qiagen). Genomic DNA extraction was performed using the DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was extracted using miRNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted by miRNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA was extracted (DNeasy 96 Plant Kit, Qiagen). Genotyping of segregating seedling populations was performed by PCR using primers listed in Methods S3 ...
-
bioRxiv - Biochemistry 2019Quote: ... by using QuantiTect® Reverse Transcription Kit (Qiagen) and qRT-PCR was performed as described (38) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Genomic DNA was extracted using QiAMP kit (Qiagen) and PCR was performed in two steps ...
-
bioRxiv - Physiology 2020Quote: ... was extracted with the RNeasy Mini Kit (Qiagen) and processed for microarray at the core facility in the University of Chicago (Chicago ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the QIAsymphony DNA Mini Kit (Qiagen, Germany), following the manufacturer’s instructions and protocol.
-
bioRxiv - Cell Biology 2019Quote: ... and then with an RNeasy MiniElute kit (Qiagen) for cleanup ...
-
bioRxiv - Microbiology 2019Quote: ... DsRNA was purified using the RNeasy kit (Qiagen) and 0.2 μg in 69 nL was injected into the thorax of A ...
-
bioRxiv - Microbiology 2019Quote: ... or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... using the QIAxcel RNA QC Kit v2.0 (Qiagen) according to protocol ...
-
bioRxiv - Genomics 2021Quote: ... and pods) using an RNeasy Mini Kit (Qiagen) and treated with RQ1 RNase-Free DNase (Promega ...
-
bioRxiv - Genomics 2021Quote: ... DNA was purified via MinElute kit by Qiagen. qPCR was performed from this purified DNA described in the protocol to estimate the optimum number of enrichment cycles ...
-
bioRxiv - Genomics 2021Quote: ... first using PCR mini-elute purification kit (Qiagen) and then using 2.2x SPRI beads (Beckman-Coulter).
-
bioRxiv - Genetics 2020Quote: ... RNA was isolated using RNeasy Mini kit (Qiagen) adding the DNase I optional step or as described in detail before31 ...
-
bioRxiv - Genetics 2020Quote: ... with columns from the RNeasy Micro Kit (Qiagen) employed for the patellar ligament ...
-
bioRxiv - Genetics 2020Quote: ... or the RNeasy Plus Mini kit (Qiagen #74136) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted using miRNeasy Mini Kit (Qiagen). Libraries were prepared using 1 µg of high-quality total RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... treated and cleaned using RNeasy Mini Kit (Qiagen). The overall quality of an RNA preparation was assessed by electrophoresis on a denaturing agarose gel.
-
bioRxiv - Evolutionary Biology 2020Quote: RNA was isolated using RNeasy micro kit (QIAGEN) and resuspended in 15 μl of water ...
-
bioRxiv - Evolutionary Biology 2020Quote: RNA was isolated by RNeasy mini kit (Qiagen) from BJ5ta cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) was used to extract DNA of each colony for verification of the clonal genotype (rs11031006 forward ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA was extracted using RNeasy kits (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: Plasmid DNA was isolated using miniprep kits (QIAGEN), with modifications for GBS as described elsewhere (28) ...
-
bioRxiv - Physiology 2021Quote: ... followed by clean up using RNeasy kits (Qiagen). Transcripts were profiled using the Lexogen QuantSeq 3’ mRNA kit to ‘count’ transcript abundance ...
-
bioRxiv - Microbiology 2021Quote: ... in one-step probe RT-qPCR kits (Qiagen) with the following cycle conditions ...
-
bioRxiv - Genetics 2021Quote: ... or the QIAQuick PCR purification kit (Qiagen 28104) and used as a template for in vitro transcription of the sgRNA with the T7 MEGAshortscript™ Kit (ThermoFisher AM1354).
-
bioRxiv - Physiology 2020Quote: ... the Qiagen RNAase mini kit (Qiagen; Valencia, CA) protocol was followed ...
-
bioRxiv - Cell Biology 2021Quote: ... the Qiaprep Spin Miniprep Kit (Qiagen, Germantown, MD) was used to isolate the plasmid ...
-
bioRxiv - Molecular Biology 2020Quote: ... purified with Qiagen MinElute PCR purification kit (Qiagen) and PCR-amplified with 8-9 cycles ...
-
bioRxiv - Neuroscience 2021Quote: RNA was isolated using RNeasy Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... recovered using a QIAquick PCR purification kit (Qiagen). The ChIP DNA and input DNA were recovered and dissolved in water for ChIP-seq and ChIP-qPCR analysis.
-
bioRxiv - Microbiology 2021Quote: ... Power Clean Pro DNA clean up kit (Qiagen) was used to purify 10 μg of DNA following manufacturer’s instructions except for any vortexing which was substituted by flickering of the tubes to preserve the integrity of the high-molecular-weight DNA ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted using an RNeasy kit (Qiagen) and reverse transcription of RNA performed using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... murina were isolated using RNeasy Mini kit (Qiagen).
-
bioRxiv - Molecular Biology 2021Quote: ... QT4 and KT4 using miRNeasy Micro kit (Qiagen) and RNAse-free DNAse according to the manufacturer’s instructions (Qiagen) ...
-
bioRxiv - Physiology 2021Quote: ... or RNeasy Lipid Tissue mini kit (74804, Qiagen) according to the manufacturer’s protocol ...