Labshake search
Citations for Qiagen :
2951 - 3000 of 10000+ citations for QuantiChrom Arginase Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and concentrated using a PCR purification kit (Qiagen). 3 µl of 10 µM stock tracRNA (IDT ...
-
bioRxiv - Cancer Biology 2024Quote: ... and RNA was extracted using RNeasy Kits (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNeasy Mini Kit was from Qiagen (Germantown, MD). Permafluor ...
-
bioRxiv - Neuroscience 2024Quote: ... using the QuantiTect Reverse Transcription kit (205311, Qiagen). DNA templates were amplified with the following PCR primers ...
-
bioRxiv - Genetics 2024Quote: ... RNA was extracted with RNeasy mini kit (Qiagen) followed by reverse transcription using the Fastquant RT kit (Tiangen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted using the RNeasy Kit (Qiagen); library generation and subsequent sequencing was performed by the clinical genomics lab (CGL ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by the Qiaprep Spin Miniprep Kit (Qiagen). Genomic DNA was isolated via the GeneJet Genomic DNA Purification Kit (Thermo Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... and purified using QIAquick PCR Purification Kit (QIAGEN). The quality and concentration of the linearized plasmid were confirmed via gel-electrophoresis and Nanodrop Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... For cRNA purification the RNeasy Mini Kit (QIAGEN) was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA isolated using RNeasy Mini Kit (Qiagen) and used for RNA sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted using an Rneasy Kit (Qiagen), and reverse-transcribed with the Lunascript Reverse Transcription kit (New England Biolab ...
-
bioRxiv - Cancer Biology 2024Quote: Standard protocols from the miRNeasy Mini kit (Qiagen) was used to extract total RNA with the inclusion of on-column genomic DNA digestion step using the RNase-free DNase Kit (Qaigen) ...
-
bioRxiv - Cell Biology 2024Quote: RNA was extracted using RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: RNAs were extracted with RNAeasy mini kit (Qiagen) including DNase treatment ...
-
bioRxiv - Microbiology 2024Quote: ... was extracted with DNeasy PowerLyzer Microbial Kit (QIAGEN) to assess if the contamination was present in the original samples ...
-
bioRxiv - Neuroscience 2024Quote: ... mRNA was isolated using RNeasy Mini Kit (Qiagen) and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the miRCURY LNA RT Kit (Qiagen, UK) was used to conduct qPCR in the Roche ® LightCycler® 480 according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Viral RNA extraction (QiaAmp Viral RNA kit, Qiagen) was performed using a 140 μL volume of each nasal lavage sample or virus stock ...
-
bioRxiv - Microbiology 2023Quote: ... Following PCR purification (Qiagen QiaQuick PCR Purification Kit), cDNA was processed at the ENPRC core for sequencing on an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Microbiology 2023Quote: Viral RNA extraction (QiaAmp Viral RNA kit, Qiagen) was performed using a 140 μL volume of each nasal lavage sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified by Plasmid Maxi Kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Fecal DNA was extracted using PowerFecal kits (Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the RNeasy Mini kit (Qiagen). A sample for microinjection was prepared by mixing two guide RNAs in water (25 ng/μl for each ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNAs were extracted using RNeasy Mini Kit (Qiagen) and infection confirmed using RT-qPCR quantification of viral RNAs using specific primers pairs ...
-
bioRxiv - Pathology 2024Quote: ... and the miRNeasy Mini Kit (Qiagen; CA; USA). Total amount of isolated RNA was retrotranscribed using the MultiScribe Reverse Transcriptase kit 8 Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen). Residual DNA was removed using RNAse-Free DNase Set (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNeasy® Plus Universal Mini Kit (Qiagen, Germany) was used to extract the total RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... The DNA isolation kit (Qiagen DNeasy, Hilden, Germany) was used to isolate sperm genomic DNA according to the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... with QuantiTech SYBR Green PCR kit (Qiagen, 204141). The PCR protocol involved warming-up at 50°C for 2 min ...
-
bioRxiv - Neuroscience 2024Quote: ... using a QuantiNova Probe PCR Kit (Qiagen, 208254) following the kit protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and purified using QIAquick PCR Purification Kit (QIAGEN). The concentration and quality of the linearised plasmid were confirmed using NanoDrop Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... containing a Lysis buffer ((RNeasy Micro Kit (Qiagen)) ...
-
bioRxiv - Cell Biology 2024Quote: Was done using an miRNeasy Mini kit (Qiagen) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and gel purified (QIAquick Gel Extraction Kit; Qiagen) and transformed into DH5α competent cells (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... using DNeasy Blood & Tissue Kit (Qiagen, Germany, Hilden) with some modification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... either using the QIAquick Gel Extraction kit (Qiagen) or by soaking the plugs overnight in 100 ul nuclease-free water at 4 °C followed by 1 h at −80 °C and recovered at 23,000 x g ...
-
bioRxiv - Developmental Biology 2024Quote: ... extracted using the MinElute Gel Extraction Kit (Qiagen) according to the manufacturer’s protocol and sequenced by Genewiz (Azenta Life Sciences) ...
-
bioRxiv - Genetics 2024Quote: ... Purification with the QIAquick PCR purification Kit (Qiagen) was followed to proceed with the PCR amplification step ...
-
bioRxiv - Genetics 2024Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen) with on column DNase treatment and quantified with a Qubit RNA BR Assay kit (Molecular Probes) ...
-
bioRxiv - Immunology 2024Quote: ... and RNeasy Mini kit (QIAGEN Cat. No. 74104), respectively ...
-
bioRxiv - Genomics 2024Quote: ... using the AllPrep DNA/RNA mini kit (Qiagen). Poly-A RNA was isolated using Dynabeads oligo(dT)25 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... using QuantiNova SYBR Green PCR Kit (208054, Qiagen). All primer sequences are shown in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: Organoid RNA was isolated using RNAeasy kit (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cleaned-up using the RNeasy kit (Qiagen, UK) and cDNA was synthesized with the High Capacity cDNA Transcription kit (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... miRNeasy Mini kit for RNA isolation (Qiagen 217004), and nuclease-free water (Life Technologies AM9937 ...
-
bioRxiv - Immunology 2024Quote: ... and purification with an RNeasy purification kit (Qiagen). Recombinant WT SARS-CoV-2 full-length S protein and RBD (aa319-545 ...
-
bioRxiv - Immunology 2024Quote: ... Shank3b+/+ mice using RNeasy Plus Mini Kit (Qiagen), and retro-transcribed to cDNA as reported in our previous work (12,43) ...
-
bioRxiv - Microbiology 2024Quote: RNA extraction was performed using RNeasy Kit (Qiagen) according to supplier’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... coli using the QIAprep Spin Miniprep Kit (Qiagen). All plasmids made by PCR cloning were sequenced by Azenta ...