Labshake search
Citations for Qiagen :
251 - 300 of 10000+ citations for hsa mir 33a 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR was performed using the SYBR Green labeling method (Qiagen; QuantiTect SYBR Green PCR kit #204143) on an Applied Bioscience QuantStudio thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was conducted using the “Rotor-Gene Q” real-time PCR cycler (Qiagen) and the following primers ...
-
bioRxiv - Molecular Biology 2019Quote: All assays were performed on a real-time PCR (Rotor Gene Q, Qiagen). PCR reactions were set-up using the complementary QIAgility robotic pipettor (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: Real-time PCR was performed using RT2 SYBR Green ROX qPCR Mastermix (Qiagen) on Viaa7 (Applied Biosystems ...
-
bioRxiv - Biophysics 2020Quote: ... Real-Time PCR was performed with specific primers purchased from Qiagen (Tables 1,2) and Power SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real time PCR was performed using SYBR Green with QuantiTect Primers (Qiagen) and using ppia gene as a reference gene ...
-
bioRxiv - Physiology 2020Quote: ... and sXbp1 (Mm03464496) in a Rotor-Gene-Q real-time PCR cycler (Qiagen). The gene Rplp0 (Mm01974474 ...
-
bioRxiv - Microbiology 2021Quote: ... TaqMan real-time PCR was performed on a Roter-Gene Q System (Qiagen) using a Thunderbird SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Cell Biology 2022Quote: ... was analyzed directly by qPCR in Real-time PCR cycler RotorGene 3000 (Qiagen) using Rotor-Gene 6.0 software ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative real-time PCR reaction was performed on a Rotor-Gene Q (Qiagen) using 10 µL FastStart SYBR Green Master (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR was performed on a Rotor-Gene Q real-time PCR cycler (Qiagen), a two-step run was programmed ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR reactions were performed using the OneStep RT-PCR Kit (Qiagen) with only very few differences compared to the detection assay ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesised and PCR amplified with Onestep RT-PCR kit (Qiagen). Ighv alleles were amplified using a common variable region primer msVHE (5’GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG3’ ...
-
bioRxiv - Microbiology 2020Quote: ... ARTD14 and ARTD15 were analyzed by quantitative real-time PCR (qRT-PCR) using QuantiTect Primer Assays (QIAGEN). In all settings the mRNA expression of the gene of interest was normalized to GUS (forward 5’-CTCATTTGGAATTTTGCCGATT-3’ and reverse 5’-CCGAGTGAAGATCCCCTTTTTA-3’ ...
-
bioRxiv - Molecular Biology 2019Quote: Quantification of miR-9-5p expression in kidney mice samples was performed using the miRCURY LNA RT Kit (Qiagen). Following RT ...
-
bioRxiv - Bioengineering 2020Quote: ... using the QuantiTect SYBR Green RT-PCR kit (Qiagen). Cycle conditions were as follows ...
-
bioRxiv - Bioengineering 2021Quote: ... using the QuantiTect SYBR Green RT-PCR kit (Qiagen). Cycle conditions were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... or QuantiNova SYBR Green RT-PCR Kit (Qiagen, MD) per manufacturer’s protocol on a QuantStudio 3 (Applied Biosystems ...
-
bioRxiv - Pathology 2021Quote: ... the RT-qPCR reaction was prepared using the OneStep RT-PCR kit (Qiagen, Germany), adjusted to a volume of 12.5 µl with an internal control mastermix ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCRs and qPCRs were performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen) respectively with and without RT on a LightCycler 480 (Roche).
-
bioRxiv - Synthetic Biology 2022Quote: ... RT-PCR on the recovered mRNA was performed using the SensiScript RT Kit (Qiagen) with reverse primers that bound the 3’ end of each POI sequence ...
-
bioRxiv - Genetics 2020Quote: ... 20 µl RT-PCRs were performed as per the manufacturer’s instructions using the Qiagen One-Step RT-PCR kit (210210, Qiagen) and the following primers ...
-
bioRxiv - Cell Biology 2019Quote: ... We then used the purified RNA samples for RT-PCR with the OneStep RT-PCR kit (cat# 210210, Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Expression of the genes of interest was also confirmed using RT-PCR using the OneStep RT-PCR Kit (Qiagen) before the experiment was conducted ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with 200 ng of extracted total RNA using a Qiagen OneStep RT-PCR Kit (Qiagen). The primers used were a forward primer (Hokkaido System Science ...
-
bioRxiv - Cancer Biology 2023Quote: ... Expression levels of miR-142-5p were analyzed using miScript PCR System or miRCURY LNA SYBR Green PCR Kit (Qiagen). Specific primer pairs (miScript Primer Assay or miRCURY LNA miRNA PCR Assay ...
-
bioRxiv - Cancer Biology 2021Quote: ... miRNA 22-3p (Qiagen #YP00204606). The expression levels of each miRNA target were normalized to calibrators U6-snRNA or GAPDH ...
-
bioRxiv - Cell Biology 2019Quote: RT-PCR or PCR products were cleaned up with QIAquick PCR purification kit (28106, QIAGEN) or QIAquick Gel Extraction kit (28706 ...
-
bioRxiv - Microbiology 2020Quote: PCR products obtained by above RT-PCR were purified by QIAquick PCR Purification Kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR was performed using the QuantiTech SYBR Green RT-PCR kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-PCR was conducted using QuantiTect SYBR Green PCR Kit (Qiagen; Germantown, MD) in 96 well PCR plates (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative RT-PCR was performed using the RotorGene SyBr Green PCR kit (Qiagen) in a Rotorgene Q PCR cycler under the following amplification conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... miR-29b and miR-29c (Qiagen), using Lipofectamine 2000 transfection reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Quantitative TaqMan real-time PCR was performed with a Q6000 machine (Qiagen, Hilden, Germany), using TaqMan premix (Takara Corporation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Quantitative real time-PCR was performed with specific primers from QIAGEN (Valencia, CA, USA) and detection reagent SYBR Green mix (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was quantified on Rotor-Gene Q real-time PCR cycler (Qiagen, Hilden, Germany) using Q-Rex Software and Investigator Quantiplex Pro RGQ Kit ...
-
bioRxiv - Immunology 2021Quote: ... Expression levels were determined by quantitative real-time PCR on a Rotorgene 3000 (Qiagen Instruments ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative real time PCR was performed with the SYBR Green system (204145, Qiagen UK) and using primers from Qiagen targeting Per1 (QT00113337) ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed with a Rotor-Gene Q 2plex HRM thermocycler (Qiagen) using an SYBR Green reagent (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was done using a Rotor-Gene Q machine (Qiagen, Hilden, Germany) with the QuantiTect SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Physiology 2023Quote: ... and real-time polymerase chain reaction (PCR) was performed with Fast SYBR Green (QIAGEN). Gapdh was used as the housekeeping gene ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative real-time PCR (qPCR) was performed using a Rotor-Gene Q instrument (Qiagen). TaqMan MGB primer/probe sets and Eukaryotic 18S rRNA VIC primer/probe set endogenous control (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... gapdh (Assay ID: Mm99999915_g1) on the Rotor-Gene Q real-time PCR cycler (Qiagen). Thermal cycling conditions included an initial denaturation step at 95°C for 10 min followed by 40 cycles of 95°C for 15s and 60°C for 1 min ...
-
bioRxiv - Microbiology 2023Quote: ... The amplification reaction was conducted using a Rotor-Gene-Q PCR Cycler Real-Time PCR system (Qiagen, Australia). The cycling parameters were as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR reaction was carried out using the QuantiNova Kit Probe RT-PCR Kit (Qiagen, catalog #208354, Germany), using primers and probe described in Naveca et al ...
-
bioRxiv - Microbiology 2023Quote: ... Primers and probe targeting the AIV matrix gene 36 were used to perform the quantitative RT-PCR (qRT-PCR) reaction by using the One-Step RT-PCR Kit (QIAGEN, Valencia, CA, USA) on a StepOne Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: RT-qPCR was carried out using QuantiTect SYBR® Green RT-PCR Kit (Qiagen, 204243) using the primer pairs detailed in Supplementary Table S11 ...
-
bioRxiv - Microbiology 2022Quote: ... One-step RT-qPCR was performed with QuantiFast Probe RT-PCR+ROX Vial Kit (Qiagen) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... primer sets were designed based on the Medaka-polished contigs and used for the RT-PCR amplification of regions of interest using the OneStep RT-PCR kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The cells previously frozen in plates were thawed on ice and RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) protocol without modification ...