Labshake search
Citations for Qiagen :
251 - 300 of 539 citations for ZBTB42 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: siRNAs targeting xCT (SLC7A11) were obtained from Qiagen. Control siRNA (ON-TARGET plus nontargeting pool ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNAs targeting TLNRD1 were purchased from QIAGEN (siTLNRD1#6 ...
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: ... (AllStars Hs Cell Death Control siRNA from Qiagen), and siRNA against IKKγ ...
-
bioRxiv - Molecular Biology 2021Quote: ... or PTBP siRNAs (Qiagen cat# SI02649206 and SI04255146) using Lipofectamine RNAiMAX (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and FlexiTube siRNAs for Smg6 and Smg7 (Qiagen) were used ...
-
bioRxiv - Immunology 2021Quote: ... non-targeting control siRNA was from Qiagen (1027281).
-
bioRxiv - Cell Biology 2021Quote: ... The following siRNAs were used: AllStars (Qiagen; SI03650318), Grb2-targeting siRNA oligos GAAAGGAGCUUGCCACGGGUU and CGAAGAAUGUGAUCAGAACUU ...
-
bioRxiv - Cell Biology 2021Quote: ... SiRNAs were obtained from Qiagen (Supplemental Table S3). SiRNA forward transfections with Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transfected with siRNA using HiPerfect (Qiagen). We used 20 nM KDM4A FlexiTube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... An AllStars (AS) Negative Control scrambled siRNA (Qiagen) with no homology to any known mammalian gene was used as a negative control ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA against Nup50 (SI00663236) was obtained from Qiagen. The siRNA against mouse Nup50 (156930 ...
-
bioRxiv - Cell Biology 2021Quote: ... Allstars Negative Control siRNA (Qiagen, Venlo, The Netherlands) was used as the negative control (siCTL) ...
-
bioRxiv - Cell Biology 2020Quote: ... and AllStars negative control siRNA (Qiagen cat# 1027281). siRNAs were delivered into cells using Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... siRNAs were transfected using the HiPerfect reagent (Qiagen) into primary human monocyte-derived macrophages 72 h before or into THP-1 cells 48 h before experimental assays ...
-
bioRxiv - Physiology 2022Quote: ... Allstars Negative Control siRNA (Qiagen, Venlo, the Netherlands) was used as a negative control (siCTRL) ...
-
bioRxiv - Developmental Biology 2022Quote: ... or Setd3 siRNAs (Qiagen 1027416, Gene ID: 52690) were injected at 2.5 μM.
-
bioRxiv - Microbiology 2020Quote: ... AllStars negative control siRNA was purchased from Qiagen. siRNAs targeting ribosome proteins were purchased as an RNAi Cherry Pick library from Dharmacon ...
-
bioRxiv - Molecular Biology 2022Quote: Allstars Negative Control siRNA (Qiagen, Catalog no. 1027281) were used as control siRNAs ...
-
bioRxiv - Genomics 2019Quote: ... Gene-specific siRNAs used: NF-YA (Qiagen, SI01327193), NF-YB (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... The following siRNA sequences were synthesized by QIAGEN: RNF2 #1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Transfection of Flexi-Tube Negative Control siRNA (Qiagen) at a final concentration of 75nM was used as negative control.
-
bioRxiv - Neuroscience 2019Quote: ... 5nmol of Rho-1 siRNA (Qiagen, Germany #SI01401743) was diluted in rnase-free water (provided in kit ...
-
bioRxiv - Cell Biology 2020Quote: ... and non-targeting siRNA were ordered from Qiagen and Dharmacon and transfected by Lipofectamine RNAimax reagent (Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... and Rn_RGD:621097_2 FlexiTube siRNA (Qiagen, Cat# SI02002434). The siRNA targeting luciferase (5’-AACGTACGCGGAATACTTCGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... SMAD3 or a negative control scrambled siRNA (Qiagen) were transfected into fibroblasts using Lipofectamine 2000 (Thermo Fisher) ...
-
bioRxiv - Systems Biology 2022Quote: ... We knocked down kinases using siRNAs from Qiagen (see spreadsheet for the ordering numbers of the siRNAs used ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were treated with control siRNA (Qiagen, 1027280), siRNA for ANXA2 (Human ...
-
bioRxiv - Cell Biology 2023Quote: ... or siRNA for Anxa2 (Mouse, Qiagen, Mm_Anxa2_3, SI00167496).
-
bioRxiv - Cell Biology 2023Quote: VSMC siRNA transfection was performed using HiPerFect (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... or 30 nM AllStars negative-control siRNA (QIAGEN). A 72-hour incubation period was used to deplete the target protein.
-
bioRxiv - Developmental Biology 2023Quote: ... HUVECs were transfected with siRNA obtained from QIAGEN (Hs_LFNG_13 FlexiTube siRNA ...
-
bioRxiv - Cell Biology 2023Quote: HAECs were transfected with siRNA designed by Qiagen to target Rho-GDI-1 and the downregulation of mRNA expression confirmed by PCR using a standard protocols ...
-
bioRxiv - Genetics 2023Quote: ... or negative control (AllStars Negative Control siRNA, QIAGEN) was transfection with DharmaFECT (FisherScientific ...
-
bioRxiv - Genetics 2023Quote: ... or negative control (AllStars Negative Control siRNA, QIAGEN) was transfection with DharmaFECT (FisherScientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Four siRNAs (#SI00039704, #SI00039711, #SI00039718, #SI03102659, all Qiagen) were used for glycodelin siRNA knockdown ...
-
bioRxiv - Immunology 2021Quote: ARNO siRNA (Mm_Pscd2_3) or a negative non-specific siRNA control (Allstar siRNA) were transfected into SFs using HiPerFect transfection reagent (all Qiagen,UK) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene of interest (GOI) siRNA or control siRNA were incubated at room temperature with Enhancer R and Buffer EC-R (Qiagen, USA) for 20 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... c-Cbl (s2476) (Table S1) or a negative control siRNA (Silencer™ Negative Control No. 2 siRNA) using HiPerfect Transfection Reagent (Qiagen) per manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Immunology 2022Quote: ... or non-targeting AllStars negative control siRNA (Qiagen-1027280) were transfected into 293T cells (25 pmol of siRNA ...
-
bioRxiv - Molecular Biology 2019Quote: All short interference RNA (siRNA) were supplied by Qiagen, scrambled siRNA (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used the same set of two siRNAs (Qiagen) against HNF1B compared with negative and positive control siRNA (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... siRNA transfection was performed with HiPerFect Transfection Reagent (Qiagen) with a final concentration of 50nM siRNA (see Supplementary Table 2 for the siRNAs used).
-
bioRxiv - Cancer Biology 2020Quote: ... siRNA transfections were performed using HiPerfect transfection reagent (Qiagen) and 75 ng of relevant siRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen, GS3091). Cells incubated for 48 h prior to exposure to oxygen conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... a silencing siRNA kit was purchased from Qiagen (1027416) and used as the combination of 4 different siRNA at 2.5nM each one ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a non-targeting negative control siRNA (AllStars, Qiagen) were used at a final concentration of 5 nM and mixed with 1.3 µl of Lipofectamine RNAiMAX (Thermo Fisher Scientific) ...