Labshake search
Citations for Qiagen :
251 - 300 of 1278 citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... n=3) using the RNeasy Mini kit (Cat. No. 74104, QIAGEN, Hilden, German) and manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP was first isolated using Ni-NTA beads (Qiagen, Valencia, CA) using a buffer with an imidazole gradient (20 mM Bis-Tris ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted with RNeasy Mini kit (cat. n° 74106, Qiagen, Hilden, Germany), treated with the TURBO DNA-free™ kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted using Qiagen 96-well DNeasy kits (Qiagen P/N 69581). Sequencing libraries were prepared using the Illumina Nextera Kit and custom barcoded adapter sequences ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RPR2 (n=6) primary tumors was performed using RNeasy Mini Kit (Qiagen) with the standard protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA were extracted using RNeasy micro kit (Qiagen 74004, n°lot 136257409), tissues protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... HF n=8) using the Qiagen RNeasy Plus Mini Kit (Qiagen, Toronto ON). RNA was quantified by spectrophotometry (DeNovix ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... n = 3) from patient and control tissues using the RNeasy mini kit (Qiagen) and diluted to a concentration of 10ng/µL ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% N-Lauroylsarcosine salt and 0.2% Triton-X100 and passed through Miniprep (QIAGEN) silica-fibre membrane spin columns in order to bind only the Top2cc’s and not DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and His-tagged tIgM-Fc (tFcµ) protein was purified using Ni-NTA Agarose (Qiagen) and subsequently ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant protein was purified with agarose beads that bind specifically to the His-tag (Ni-NTA Agarose, Qiagen) following the purification hybrid method from the ProBond purification system (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... The His and GST tag were cleaved by the Tev protease and separated from AtPAXXL228E using Ni-NTA (Qiagen). AtPAXXL228E was loaded onto a HiTrap Q HP column equilibrated with 20 mM Tris pH7.4 ...
-
bioRxiv - Biochemistry 2023Quote: ... GB1 tag was produced by thrombin cleavage of GB1-ICD and removal of ICD using nickel-NTA resin (Qiagen). NMR spectra were collected on a Bruker 700 MHz spectrometer at Iowa State University equipped with z-shielded gradient triple resonance 5 mm TCI cryoprobe ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified using the QIAquick PCR Purification kit (QIAGEN, cat. n° 28104), and digested DNA products were extracted from the agarose gel using the QIAquick Gel Extraction kit (QIAGEN ...
-
The alopecia areata phenotype is induced by the water avoidance stress test in cchcr1-deficient micebioRxiv - Genetics 2020Quote: ... RNA samples were purified by an RNeasy MinElute kit (QIAGEN N N.V., Venlo, Netherlands).
-
bioRxiv - Molecular Biology 2020Quote: ... selected by p value and/or fold change (FC) as indicated were uploaded into the IPA software (Qiagen). The Core Analyses function included in the software was used to interpret the data for top canonical pathways.
-
bioRxiv - Microbiology 2023Quote: ... All treatment groups were supplemented with 1 % FCS and RNA was extracted in RNAeasy Plus lysis buffer (QIAGEN) 6 h post treatment.
-
bioRxiv - Biophysics 2021Quote: ... PNGase F and the cleaved 10 × His tag were removed by passing the sample through Ni-NTA superflow resin (QIAGEN). The receptor was concentrated to 20–30 mg/ml with a 100 kDa cut-off concentrator (Millipore) ...
-
bioRxiv - Biophysics 2021Quote: ... NF-κB molecules were immobilized through the 6xHis-tag on the C-terminus of RelA by penta-His antibody biotin conjugate (34440, Qiagen). For DNA-bound NF-κB experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... For PCR amplification of the V5 tag cDNA was extracted from cells and a PCR was performed using the QIAquick PCR purification kit (QIAGEN) and the following primer sequences ...
-
bioRxiv - Biophysics 2022Quote: ... Cell debris was cleared by centrifugation at 40,000 g for 45 min at 4°C and supernatant was applied to His-tag affinity purification using Ni-NTA agarose (beads or 5 ml column, Qiagen) in buffer A (50 mM TRIS ...
-
bioRxiv - Microbiology 2023Quote: ... Pulled-down fractions were analysed by SDS-PAGE or Western blot using rabbit antibodies against KtrB or mouse against His-tag (Qiagen).
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated before (T1) and after (T2) the sample-tag staining procedure using the RNeasy Mini kit (Qiagen) and RNA quality (RNA integrity number ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µL from the supernatant and cell lysates were applied on a nylon membrane and two different antibodies (an HRP-conjugated anti-His tag from Qiagen and an HRP-conjugated anti-strep tag from Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ligated fragments were then amplified for 12-15 cycles using primers incorporating unique dual index tags with VeraSeq polymerase (Qiagen). Fragments were sequenced on an Illumina NovaSeq-6000 using paired end reads extending 150 bases.
-
bioRxiv - Neuroscience 2021Quote: ... n=10) was homogenized using the PowerGen 125 handheld homogenizer in QIAzol Lysis Reagent (Qiagen) and extracted using the RNeasy Plus Universal Mini Kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS ...
-
bioRxiv - Microbiology 2023Quote: ... Typhimurium strain were (n = 3) were extracted using the Rneasy kit (Qiagen Sciences, Maryland, USA), after an overnight culture in CBD tinted LB broth (for CBD-resistant strain ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular RNAs were instead extracted using an RNAeasy mini extraction kit (Qiagen, cat. n. 74004) and then treated as described above ...
-
bioRxiv - Microbiology 2019Quote: ... Short CAP was expressed and His tag purified using Ni-NTA affinity purification under native conditions using the standard manufacturer’s protocol (Qiagen, Hilden, Germany). The shortCAP recombinant protein was used to immunize female New Zealand white rabbits (Covalab ...
-
bioRxiv - Developmental Biology 2020Quote: ... mUHRF1 C-terminally tagged with GFP- and 6xHis-tag was expressed in HEK 293T cells and then purified using Qiagen Ni-NTA beads (Qiagen #30230). Recombinant mDPPA3 WT and 1-60 were purified as described above ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Clarified supernatants containing TtgR and SmtB were purified using His-tag affinity chromatography with a gravity column charged with Ni-NTA Agarose (Qiagen #30210). The eluted fractions from the FPLC (for TetR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Clarified supernatant containing mRFP1 was then purified using His-tag affinity chromatography with a gravity column charged with Ni-NTA Agarose (Qiagen #30210). The elution from the gravity column was concentrated and buffer exchanged (25 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Neuroscience 2021Quote: RNA was extracted from SH-SY5Y and SK-N-DZ cells with a RNeasy kit (Qiagen) using the manufacturer‘s protocol including the on column DNA digestion step ...
-
bioRxiv - Microbiology 2021Quote: ... Larger DZIF N product fragments were excised and purified using the QIAquick Gel Extraction kit (Qiagen) and analyzed by Sanger sequencing using the DZIF N forward and reverse primers ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA from transfectant parasites was isolated with QIAamp DNA blood Kit (Qiagen, Cat. N° 51106) and diagnostic PCRs were set using Taq Phusion DNA polymerase (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... or FTA-dried blood spot samples (n = 26) using the QIAamp DNA Blood Mini Kit (Qiagen). For fecal samples ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA (n=3/experimental group) was extracted from macrophages with RNeasy Mini Kit (Qiagen, USA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Cancer Biology 2024Quote: ... and total RNA was extracted using the RNAeasy Mini kit (Qiagen, 74104; n = 3 independent experiments). Prior to library construction ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis of 100 ng total RNA was performed with miRCURY LNA RT Kit (10 µl volume reaction) which adds a 5’ universal tag of a poly(A) tail to mature miRNA templates (QIAGEN, Germantown, MD). cDNA template was diluted 1:10 ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tag fusions were purified by incubating the bacterial soluble fraction with pre-equilibrated Ni-NTA agarose bead slurry (Qiagen, Hilden, Germany) for 1 hour at 4°C and eluting with 500 mM imidazole ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)