Labshake search
Citations for Qiagen :
251 - 300 of 1020 citations for Recombinant Human SNCG Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: Dissociated human islets cells were transfected with scramble siRNA (Cat# 1027284, Qiagen, Toronto, Canada) or siRNA from ThermoFisher Scientific against OGDHL (ID# s31422) ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total RNA was extracted from cultured human ECs using a RNeasy Mini kit (Qiagen). For reverse transcription ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or human ABCB1-transfected MDR-19 cells using the RNeasy Mini extraction kit (Qiagen). First strand cDNA synthesis was performed on 500 ng of template RNA using MMLV reverse transcriptase (fc 10 units/µl) ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
bioRxiv - Genomics 2024Quote: ... genomic DNA from human primary T cells was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from human cells using RNeasy Mini kits (QIAGEN, Hilden, Germany) and reverse transcribed using Super-Script III (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: Transfected iPSC-OPCs and post-mortem human MS samples were lysed in Qiazol (Qiagen), and RNA was isolated using a standard chloroform extraction and ethanol precipitation method ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: Bacterial and human cells were treated with RNAprotect cell or bacterial reagent (Qiagen, Germany) and stored at -80°C for up to 1 week ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from human islets using the miRNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from primary human PTC with the RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: A human mitochondrial energy metabolism PCR array (Qiagen RT2 Profiler PCR Arrays, PAHS-008YA) was performed from cDNA synthesized from 1 µg of total RNA from the tumors of control and CPI-613 treated mice ...
-
bioRxiv - Microbiology 2019Quote: ... and the 6xHis-SUMO tagged proteins were purified from the soluble protein fraction after centrifugation using an Ni2+-NTA Superflow column (Qiagen, Venlo, Netherlands). Next ...
-
bioRxiv - Cancer Biology 2021Quote: The recombinant hexahistidine-tagged TNC-C and EDB WT and mutant proteins (at 60 μg of protein / 40 μl beads in PBS) were immobilized to Ni-NTA Magnetic Agarose Beads (QIAGEN, Hilden, Germany) at RT for 1 h ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA and protein fractions using silica-membrane spin columns from the AllPrep DNA/RNA/Protein kit (cat# 80004, Qiagen, Chatsworth, CA, USA). PBMCs were processed in a randomized order ...
-
bioRxiv - Neuroscience 2023Quote: PFC and HPC RNA and protein were extracted following the instructions of the Allprep RNA/protein kit (cataloge no. 80404; Qiagen, Hilden, Germany). RNA was measured by nanodrop ...
-
bioRxiv - Cancer Biology 2019Quote: ... His-tagged proteins were purified on NiNTA beads (Qiagen). Purified proteins were eluted with 500 mM NaCl ...
-
bioRxiv - Genomics 2019Quote: We used Allprep DNA/RNA/Protein mini kit (Qiagen) for DNA isolations from FNAs and QIAamp DNA Kit for blood and plasma ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA extraction with All Prep RNA/Protein Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... RNA and Allprep DNA RNA Protein Mini Kit (QIAGEN) extraction kit according to the manufacturer’s specifications.
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were purified with Ni-NTA affinity resin (Qiagen). The aminoacylation assay protocol from Jiongming Lu was then followed (Lu et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein were purified using Ni-NTA agrose (Qiagen, 30210) according to the manufacturer’s manual ...
-
bioRxiv - Biochemistry 2021Quote: ... Soluble protein was mixed with Ni-NTA resin (Qiagen) for 1h at 4 degrees on a nutator ...
-
bioRxiv - Biochemistry 2020Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... purified N protein was incubated with RNAse A (Qiagen) with 1:15 (RNAse A ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were either purified using NI-NTA agarose (Qiagen) or anti C-tag beads ...
-
bioRxiv - Plant Biology 2021Quote: ... labeled proteins were incubated with Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... the protein was purified by Ni-NTA agarose (Qiagen) and eluted with lysis buffer containing 300 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: Protein was purified using Ni-NTA agarose column (Qiagen). A detailed protocol is described in supplementary materials and methods.
-
bioRxiv - Genetics 2021Quote: ... The AllPrep DNA/RNA/Protein Mini Kit (Qiagen 80004) was used to extract total RNA in DEPC-treated water ...
-
bioRxiv - Neuroscience 2020Quote: ... GAPDH protein was purified by Ni-NTA chromatography (Qiagen) under native conditions ...
-
bioRxiv - Biophysics 2021Quote: ... Proteins were purified using Ni-NTA resin (Qiagen, Germany) on a gravity flow column followed by size-exclusion chromatography on a Superdex® 200 Increase 10/300 GL column (GE Healthcare Life Sciences ...
-
bioRxiv - Biophysics 2020Quote: ... Protein purification was performed using Ni-NTA resin (Qiagen) equilibrated with the lysis buffer containing 20 mM imidazole ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were purified by Nibaffinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Genomics 2019Quote: ... We added 200 µl of Protein Precipitation Solution (Qiagen) and centrifuged at 15,000 rpm for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Genes for protein purification were cloned into pQE30 (QIAGEN). Raw 264.7 and U937 cells were cultured in RPIM1640 medium in the presence of 10% FBS ...
-
bioRxiv - Genomics 2020Quote: ... total proteins and RNA were extracted (RNeasy Qiagen 74104) according to the manufacturer’s instructions and analyzed.
-
bioRxiv - Biochemistry 2024Quote: ... protein purification was performed using Co+NTA agarose (Qiagen), followed by a Phenyl Sepharose column ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was purified with Ni-NTA Agarose (Qiagen), dialyzed to PBS containing 6 M urea ...
-
bioRxiv - Microbiology 2023Quote: ... The proteins were purified with Ni-column chromatography (Qiagen) by following the manufacturer’s recommendations.
-
bioRxiv - Biochemistry 2023Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was purified through Ni-NTA agarose beads (Qiagen) (Lysis Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Expressed proteins were captured on Ni-NTA Superflow (Qiagen) equilibrated with Buffer A containing 5 mM imidazole ...
-
bioRxiv - Biochemistry 2023Quote: ... protein was captured using Ni-NTA affinity chromatography (Qiagen). Protein was further purified using ion exchange chromatography preceding size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were purified by Ni-NTA affinity chromatography (QIAGEN) and gel filtration chromatography (HiLoad 26/60 Superdex 75 pg ...
-
bioRxiv - Immunology 2024Quote: ... Protein content was quantified using a BCA test (Qiagen). Legendplex assay was done as per the manufacturer’s instructions using a X20 Special Order 5-laser Fortessa (BD ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were incubated with Ni-NTA Agarose (Qiagen 30230) resin ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...