Labshake search
Citations for Qiagen :
251 - 300 of 975 citations for Recombinant Human PLA2G7 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Genomics 2024Quote: ... genomic DNA from human primary T cells was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and the 6xHis-SUMO tagged proteins were purified from the soluble protein fraction after centrifugation using an Ni2+-NTA Superflow column (Qiagen, Venlo, Netherlands). Next ...
-
bioRxiv - Cancer Biology 2021Quote: The recombinant hexahistidine-tagged TNC-C and EDB WT and mutant proteins (at 60 μg of protein / 40 μl beads in PBS) were immobilized to Ni-NTA Magnetic Agarose Beads (QIAGEN, Hilden, Germany) at RT for 1 h ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA and protein fractions using silica-membrane spin columns from the AllPrep DNA/RNA/Protein kit (cat# 80004, Qiagen, Chatsworth, CA, USA). PBMCs were processed in a randomized order ...
-
bioRxiv - Neuroscience 2023Quote: PFC and HPC RNA and protein were extracted following the instructions of the Allprep RNA/protein kit (cataloge no. 80404; Qiagen, Hilden, Germany). RNA was measured by nanodrop ...
-
bioRxiv - Cancer Biology 2019Quote: ... His-tagged proteins were purified on NiNTA beads (Qiagen). Purified proteins were eluted with 500 mM NaCl ...
-
bioRxiv - Genomics 2019Quote: We used Allprep DNA/RNA/Protein mini kit (Qiagen) for DNA isolations from FNAs and QIAamp DNA Kit for blood and plasma ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA extraction with All Prep RNA/Protein Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... RNA and Allprep DNA RNA Protein Mini Kit (QIAGEN) extraction kit according to the manufacturer’s specifications.
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were purified with Ni-NTA affinity resin (Qiagen). The aminoacylation assay protocol from Jiongming Lu was then followed (Lu et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein were purified using Ni-NTA agrose (Qiagen, 30210) according to the manufacturer’s manual ...
-
bioRxiv - Biochemistry 2021Quote: ... Soluble protein was mixed with Ni-NTA resin (Qiagen) for 1h at 4 degrees on a nutator ...
-
bioRxiv - Biochemistry 2020Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... purified N protein was incubated with RNAse A (Qiagen) with 1:15 (RNAse A ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were either purified using NI-NTA agarose (Qiagen) or anti C-tag beads ...
-
bioRxiv - Plant Biology 2021Quote: ... labeled proteins were incubated with Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... the protein was purified by Ni-NTA agarose (Qiagen) and eluted with lysis buffer containing 300 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: Protein was purified using Ni-NTA agarose column (Qiagen). A detailed protocol is described in supplementary materials and methods.
-
bioRxiv - Genetics 2021Quote: ... The AllPrep DNA/RNA/Protein Mini Kit (Qiagen 80004) was used to extract total RNA in DEPC-treated water ...
-
bioRxiv - Neuroscience 2020Quote: ... GAPDH protein was purified by Ni-NTA chromatography (Qiagen) under native conditions ...
-
bioRxiv - Biophysics 2021Quote: ... Proteins were purified using Ni-NTA resin (Qiagen, Germany) on a gravity flow column followed by size-exclusion chromatography on a Superdex® 200 Increase 10/300 GL column (GE Healthcare Life Sciences ...
-
bioRxiv - Biophysics 2020Quote: ... Protein purification was performed using Ni-NTA resin (Qiagen) equilibrated with the lysis buffer containing 20 mM imidazole ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were purified by Nibaffinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Genomics 2019Quote: ... We added 200 µl of Protein Precipitation Solution (Qiagen) and centrifuged at 15,000 rpm for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Genes for protein purification were cloned into pQE30 (QIAGEN). Raw 264.7 and U937 cells were cultured in RPIM1640 medium in the presence of 10% FBS ...
-
bioRxiv - Genomics 2020Quote: ... total proteins and RNA were extracted (RNeasy Qiagen 74104) according to the manufacturer’s instructions and analyzed.
-
bioRxiv - Microbiology 2023Quote: ... The proteins were purified with Ni-column chromatography (Qiagen) by following the manufacturer’s recommendations.
-
bioRxiv - Biochemistry 2023Quote: ... Protein was purified through Ni-NTA agarose beads (Qiagen) (Lysis Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Expressed proteins were captured on Ni-NTA Superflow (Qiagen) equilibrated with Buffer A containing 5 mM imidazole ...
-
bioRxiv - Biochemistry 2023Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was purified with Ni-NTA Agarose (Qiagen), dialyzed to PBS containing 6 M urea ...
-
bioRxiv - Biochemistry 2023Quote: ... protein was captured using Ni-NTA affinity chromatography (Qiagen). Protein was further purified using ion exchange chromatography preceding size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Biochemistry 2024Quote: ... protein purification was performed using Co+NTA agarose (Qiagen), followed by a Phenyl Sepharose column ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...