Labshake search
Citations for Qiagen :
251 - 300 of 3271 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.5-1 μg of total RNA was reverse transcribed into first-strand cDNA using an RT2 First Strand Kit (QIAGEN). The resultant cDNA was subjected to qPCR using human cytokine-specific primer (Realtimeprimers.com ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA was separated on a 1% agarose gel and the ∼5 Kb genomic DNA band was harvested with a QIAquick Gel Extraction Kit (Qiagen). The DNA library was prepared according to the manual of the Ligation Sequencing Kit (Nanopore) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed by boiling (5 min 95°C) followed by bead beating (3mm beads, 30 Hz for 1 min) (TissueLyser II, Qiagen) and sonication bath (3×10 sec at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... several loci were amplified simultaneously from 1 μl of extracted DNA using 5 μl of the Multiplex PCR Master Mix (Qiagen) and varying amounts of the pooled primer mixes (Pool A ...
-
bioRxiv - Microbiology 2021Quote: ... samples were weighed and homogenized in DMEM containing 10% FBS and 1% antibiotics using 5 mm stainless steel beads (Qiagen) and the TissueLyser II (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... and homogenized twice for 1-5 minutes each at 25Hz using a TissueLyser LT sample disruptor (Qiagen, Part No. 85600) with a 12 tube Tissue Lyser LT adapter (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... CCR6int and CCR6high subsets of CD4+ T cells were used for isolating RNA without and with prior activation with 20 ng/ml PMA and 1 mM ionomycin for 3 h at 37°C under 5% CO2 using RNeasy Mini Kit (Qiagen) and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc. ...
-
bioRxiv - Genomics 2023Quote: ... The bead-bound gDNA was isothermally amplified for 3 hours at 30 °C then 10 minutes at 65 °C using a miniaturised (1/5 vols) Repli-g Single-Cell assay (Qiagen). The amplified gDNA was cleaned up with 0.8 × vols Ampure XP and 80 % ethanol ...
-
bioRxiv - Molecular Biology 2023Quote: cDNA was produced from 1 μg of total RNA (final cDNA concentration 5 ng/ml) using QuantiTech Reverse Transcription kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Metagenomic sequencing libraries were constructed from extracted DNA samples with 10 μL (1/5 volume) reactions using the QIAseq FX DNA Library Kit (QIAGEN). Each metagenomic sequencing library was sequenced using the Illumina NextSeq 2000 System 2 x 150 bp configuration.
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from input and IP samples by incubation with 1 mL Trizol at room temperature for 5 minutes and then RNeasy Lipid Tissue Mini Kit (Qiagen) via the manufacturer’s protocol with on-column DNase treatment (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Microbiology 2021Quote: ... blank DNA extraction kits (N=14)) controls using the DNeasy PowerLyzer Powersoil kit (Qiagen, Germamtown, MD, USA), with minor modifications to the manufacturer’s protocols as previously described [109 ...
-
bioRxiv - Neuroscience 2020Quote: ... the whole CNS was dissected from the snails (n=10) and homogenized using a TissueLyser LT (QIAGEN) in TRI reagent (#93289 ...
-
bioRxiv - Immunology 2021Quote: ... The samples (N=3) were collected immediately and soaked in 10 volumes of RNAlater (Qiagen, Hilden, Germany), for sequencing using Illumina (New England Biolabs) ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted (n=3) from the frozen endosperm tissue using the RNeasy PowerPlant kit (Qiagen). An on-column DNase digest was incorporated during the extraction ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 75 µL ddH2O and digested with DNaseI (QIAGen RNase-Free DNase set (ref. n°79524) for 10 min at RT ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a TEV cleavable N-terminal His-tag were purified using Ni-NTA agarose (Qiagen) resin and were treated to gel filtration using a Superose 6 Increase 16/600 column or Superdex 200 Hiload 16/600 column (Cytiva ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from patient material (n=3) and organoids (xxx) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µL RNase free water (Qiagen), 1 µL cDNA ...
-
bioRxiv - Genetics 2021Quote: ... PCR 2 products were purified by electrophoresis with a 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen) and eluting with 30 μL water ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Genomics 2022Quote: ... PCR#1 amplicons were selected on a 2% agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen). These amplicons were then used as template for “PCR#2” reactions ...
-
bioRxiv - Physiology 2022Quote: Frozen liver tissue was manually crushed and 30 mg per sample was homogenized in 1mL of 2:1 chloroform:methanol via a TissueLyser II (Qiagen). Samples were stored at 4 °C overnight with agitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... tissue was digested away from the slide by incubating the tissue with 1% 2-mercaptoethanol in RLT buffer (Qiagen) for one hour at 56°C with interval shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins with log fold change >1 and Z-score > 2 were further analyzed in Ingenuity Pathway Analysis (IPA, Qiagen) to determine pathways enriched by the bait proteins ...
-
bioRxiv - Genomics 2020Quote: ... first strand synthesis was performed by incubating the pucks in 200 μL of reverse transcription solution (Maxima 1x RT Buffer, 1 mM dNTPs, 2 U/μL Lucigen NxGen RNAse inhibitor, 2.5 μM template switch oligo with Qiagen #339414YCO0076714 ...
-
bioRxiv - Genomics 2021Quote: ... Illumina reads for each genome were mapped to the yeast reference genome (R64-2-1, yeastgenome.org) using CLC-Genomics software (Qiagen). Resulting read mapping files were then subjected to copy number and heterozygous single nucleotide polymorphism (hetSNP ...
-
bioRxiv - Genomics 2022Quote: ... Illumina reads for each genome were mapped to the yeast reference genome (R64-2-1, yeastgenome.org) using CLC-Genomics software (Qiagen). Resulting read mapping files were then subjected to copy number and heterozygous single nucleotide polymorphism (hetSNP ...
-
bioRxiv - Microbiology 2022Quote: ... 1 to 2 mL of culture were mixed with the same volume RNAprotect™ Bacteria Reagent (Qiagen, Hilden, Germany) incubated for 10 min and centrifuged ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 1-2 flies per sample were homogenized in 100 μL phosphate buffer (pH 7.5) using a TissueLyser LT (Qiagen) with 5-mm stainless-steel beads ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...