Labshake search
Citations for Qiagen :
251 - 300 of 311 citations for IZUMO4 Human HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN). After pelleting by centrifugation for 5 minutes at 5,000 x g ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Biochemistry 2022Quote: ... high molecular weight genomic DNA (gDNA) was purified from human primary T cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Gene expression of 84 heat shock genes in mock-infected or 229E-infected cells was analyzed using Human Heat Shock Proteins & Chaperones RT2 Profiler PCR array (Qiagen). Real-time PCR analyses were performed with specific primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Immunology 2023Quote: Real-time quantitative PCR (RT-qPCR) was done as previously described [Zonneveld 2021] using the Human T cell Tolerance & Anergy RT2 Profiler PCR array (Qiagen). The relative expression levels of each gene were normalized using 4 reference genes (B2M ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human U6 primer used in this experiment was included in the miScript Primer assay kit (Qiagen Inc., Germantown, MD, #218300).
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Developmental Biology 2021Quote: ... The expression levels of the mRNAs were quantified using Human Embryonic Stem Cell RT2 Profile™ PCR Array (Cat. PAHS-081, Qiagen) and RT2 SYBR Green qPCR Master Mix (Cat ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated from a 23 week human fetal heart using Trizol-based dissociation followed by the RNEasy Mini Kit (Qiagen #74104). cDNA was created from this RNA using the iScript Reverse Transcription Supermix (Bio-Rad #1708840) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was isolated from human buffy coat samples at the Crimson Core facility (Mass General Brigham) using the QIAamp DNA Blood Mini Kit (Qiagen 69504) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Reference plasmids were serially diluted in either PBS buffer or heat-inactivated normal human serum (NHS) and re-extracted using the QIAamp® DNA Blood Mini Kit (Qiagen) per recommended protocol for serum ...
-
bioRxiv - Cancer Biology 2020Quote: Flag-tagged NF1-GRD (aminoacids 1131-1534) was amplified by PCR from human cortical tissue (epilepsy patient) and first cloned in the pDRIVE vector (Qiagen #231124). Primers are listed in Supplementary Table 5 ...
-
bioRxiv - Immunology 2021Quote: ... and ImmunoCult™ Human Treg Differentiation Supplement (StemCell TechnoRNA was isolated at set time points after activation using the RNeasy Mini (Qiagen). cDNA was generated using the High-Capacity RNA-to-cDNA Kit (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted from human cell lines of WI-38 and MED13LS1497F using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exosomal miRNAs were profiled using Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, #YAHS-106Y, Plate Format: 2 × 96-well).
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... RT PCR was performed on a Roche LightCycler 96 using the The RT² Profiler™ PCR Array Human Cell Death PathwayFinder (PAHS-212Z, Qiagen)w ...
-
bioRxiv - Physiology 2023Quote: ... 1 µg of RNA isolated from human islets or 10 µL of exosomal RNA was reverse transcribed using the miRScript II kit (Qiagen, Germany), following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The association of the differentially expressed proteins with specifically dysregulated regulatory/metabolic networks in OT human samples was analyzed using QIAGEN’s Ingenuity Pathway Analysis (IPA; QIAGEN Redwood City). This software calculates significance values (p-values ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from cultured from human bronchial epithelial cells / mice right lung tissues and purified using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany), supplemented with the Proteinase K (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2021Quote: ... The expression of the BCL-2 anti-apoptotic genes in the NPC cell lines were accessed using the custom RT2 Human Apoptosis Profiler PCR array (Qiagen, Hilden, Germany). To delineate the contribution of MCL-1 for cell survival ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA from Amborella generative cells and sperm cells was extracted according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using the ‘Human Innate and Adaptive immune Response’ kit (Qiagen, Hilden, Germany) to assess the expression of genes/mRNA ...
-
bioRxiv - Microbiology 2023Quote: ... 293A cells were transfected with the plasmid of pCDNA3.1-ACE2 (human)-3×FLAG (MiaoLing Plasmid Platform, China) using polyfect (QIAGEN, West Sussex, UK) according to the manufacturer’s protocol ...