Labshake search
Citations for Qiagen :
251 - 300 of 10000+ citations for Human Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from cultured from human bronchial epithelial cells / mice right lung tissues and purified using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany), supplemented with the Proteinase K (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Genetics 2019Quote: Total RNA from human cell lines (PTC-05, HepG2 and HEK-293T) was extracted using spin columns with the RNeasy Mini Kit (QIAGEN, GmbH, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA from Amborella generative cells and sperm cells was extracted according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using the ‘Human Innate and Adaptive immune Response’ kit (Qiagen, Hilden, Germany) to assess the expression of genes/mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 ng of RNA from microdissected human pancreatic islets and from EndoC-βH1 was used to generate cDNA libraries using QiaSeq miRNA library kit (Qiagen, Hilden, Germany) following manufacturer’s instructions (see ESM Methods).
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from FACS sorted mouse brain cells stabilized in RNAprotect buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Physiology 2021Quote: 1 μg purified extracted RNA (RNeasy Mini Kit, Qiagen) was reverse transcribed using qScript Reverse Transcriptase (Quanta Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... resuspended in 1 mL RTL buffer (Qiagen RNeasy Kit) and lysed by bead beating (2 × 1 min ...
-
bioRxiv - Biophysics 2019Quote: ... proteins were purified by batch Ni-NTA bead purification (1 mL slurry/1L culture; Qiagen) and further purified by a Superdex 200 16/60 column (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA and RNA were extracted using the Qiagen AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Hilden, Germany; #80004). The standard manufacturer’s protocol was followed to extract DNA and RNA from each cell pellet ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was isolated from dissected tissues using an AllPrep DNA/RNA/Protein Mini kit (Qiagen, Valencia, CA). The concentration and purity were determined using a 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from the frozen placental tissue using the Protein and RNA Isolation (PARIS) kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The phage protein capsid was digested with Proteinase K and the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) was used to purify the DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was extracted from samples using the AllPrep DNA/RNA/Protein Mini Kit (80004, Qiagen Sciences, Inc.) and 0.25 μg of total RNA was reverse transcribed by SuperScript™ IV First-Strand cDNA Synthesis System (18091050 ...
-
bioRxiv - Immunology 2023Quote: DNA was extracted from samples using Qiagen’s AllPrep Bacterial DNA/RNA/Protein Kit (Cat# 47054; QIAGEN, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from samples using Qiagen’s AllPrep Bacterial DNA/RNA/Protein Kit (Cat# 47054; QIAGEN, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... followed by protein precipitation with the Protein Precipitation Solution (Qiagen) for 10 min at -20 °C ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from the mouse cells/tissues and human cell lines using the RNeasy® Mini Kit (Qiagen Inc., Germantown, MD). For human platelets and MEG-01 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant proteins were purified on Ni-NTA columns (1 ml Ni-NTA Agarose; Qiagen Cat # 30210), washed with 20 ml hexokinase buffer (20 mM HEPES ...
-
bioRxiv - Microbiology 2021Quote: ... Cln1-His6 and its associated proteins were co-purified following the Ni-NTA Spin Kit procedure (Qiagen, Valencia, CA). Cell lysate from the CLN1-His6 strain was used as a negative control ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were lysed and recombinant proteins were purified under native conditions using the Ni-NTA Fast Start Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Tissue lysate was further used for DNA extraction with the AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Hilden, Germany). Total DNA extraction of seawater filters was done using the entire filter ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from FACS-purified astrocytes from a single mouse brain using the QIAshredder and the All-prep DNA/RNA/protein Mini Kit according to the manufacturer’s protocol (Qiagen). Total RNA concentration was measured using a NanoVue PlusTM spectrophotometer (Biochrom) ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was isolated from these samples according to the manufacturer’s instruction using AllPrep DNA/RNA/Protein Mini Kit (Qiagen). RNA was quantified using a Nanodrop-1000 spectrophotometer (Thermo-Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were analyzed by NTA and then processed with AllPrep DNA/RNA/Protein Mini Kit (cat. no. 80004, Qiagen).
-
bioRxiv - Molecular Biology 2023Quote: Total RNA from hippocampus and pre-frontal cortex was purified with AllPrep DNA/RNA/Protein Mini Kit (QIAGEN, 80004) and DNAseI digested (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein-protein interaction networks were built using Ingenuity Pathway Analysis (IPA) (Qiagen).
-
bioRxiv - Biophysics 2021Quote: The libraries midi-preps were digested with HindIII and NheI restriction enzymes and the insert containing the mutated protein was gel purified (MinElute Gel Extraction Kit, QIAGEN) to be later cloned into the two assay plasmids by temperature-cycle ligation.
-
bioRxiv - Molecular Biology 2020Quote: RNA and protein were extracted from cell lines using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen, Valencia, CA, USA). Total RNA was also DNase treated using the TURBO DNA-free Kit (Applied Biosystems ...