Labshake search
Citations for Qiagen :
251 - 300 of 2015 citations for Enolase 1 Alpha enolase Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged ubiquitin-conjugated proteins were purified by adding 100 µL of 50 % Ni-NTA agarose beads (Qiagen) equilibrated in A2 buffer to 1 mL of cleared extracts and incubated with rotation for 2-4 hr at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 RBD-His protein was purified from cell culture supernatant using a Ni-NTA (Qiagen) affinity column ...
-
bioRxiv - Microbiology 2020Quote: A 6.5 nM concentration of His-tagged 16055 SOSIP.v8.3 trimer in TBS was added to a 96-well Ni-NTA plate (Qiagen) for 2 h at RT ...
-
bioRxiv - Biochemistry 2019Quote: ... DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... His-SFP1 was purified using Ni-NTA affinity purification under native conditions using the standard manufacturer’s protocol (Qiagen). Recombinant His-SFP1 was used to immunize female New Zealand white rabbits (Covalab ...
-
bioRxiv - Bioengineering 2020Quote: Initial small test purifications were performed using Ni-NTA Spin Column for His-Tagged proteins (Qiagen, Hilden, Germany) following the protocol for 6xHis-Tagged Proteins under Native Conditions from E ...
-
bioRxiv - Biochemistry 2020Quote: ... The Ni-NTA agarose resin for purification of his-tagged proteins was purchased from Qiagen (Germantown, MD, USA). Superdex 75 16/600 and Superdex 200 Increase 10/300 size exclusion chromatography columns were purchased from GE Healthcare (Uppsala ...
-
bioRxiv - Biochemistry 2021Quote: DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... The N-terminal His-tagged Sif protein (Lmo0946-His6) was expressed and purified using Ni-NTA resin (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Molecular Biology 2024Quote: ... The agarose gel bound with the His-tagged recombinant protein was packed in the chromatography column (Qiagen, Germany), and the flow through was discarded ...
-
bioRxiv - Plant Biology 2024Quote: ... All fractions were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using anti-His (Qiagen) and anti-strep (MilliporeSigma ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biophysics 2021Quote: ... gliding motility assays were performed with specific immobilization of motors on the surface via penta-His antibodies (34660, Qiagen) as previously described[64] (Figure S4) ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant both N-and C-terminally His-tagged proteins were purified using a Ni-NTA Superflow cartridge (1ml, Qiagen) and the Fast Protein Liquid Chromatography (FPLC ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant protein was purified with agarose beads that bind specifically to the His-tag (Ni-NTA Agarose, Qiagen) following the purification hybrid method from the ProBond purification system (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Renilla-HA-NOD2 (750 ng/well) and His-FLAG-CAD (250 ng/well) using Effectene Transfection Reagent (Qiagen). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP ± MirA was loaded onto a column with 80 µL of previously equilibrated Ni-NTA resin (Qiagen) and incubated for 1 h at 4°C with agitation ...
-
bioRxiv - Molecular Biology 2022Quote: His-Prs or its variants (10 µg) were bound to 4 µl of Ni-NTA Magnetic Agarose Beads (Qiagen) in 50 µl interaction buffer (50 mM Tris pH 9.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression levels were validated from the pWB plasmid by western blot using an anti-His HRP conjugate kit (Qiagen) (Fig ...
-
bioRxiv - Immunology 2020Quote: ... ConM-SOSIP.v7 carrying a C-terminal His-tag (diluted to 6.5nM in TBS) was immobilized onto 96-well Ni-NTA ELISA plates (Qiagen) by incubation for 2 hours at room temperature after which the plates were washed 3 times with TBS ...
-
bioRxiv - Biochemistry 2021Quote: ... was transformed with an N-terminally His-tagged fusion protein of cytHPPK/DHPS (At1g69190) in the vector pQE30 (Qiagen). Overnight cultures grown at 30°C in LB broth supplemented with 35 µg/mL kanamycin and 100 µg/mL ampicillin were sub-cultured to an OD600 of 0.6 - 0.7 and induced overnight at 16°C with 100 mM isopropyl β-D-1-thiogalactopyranoside ...
-
bioRxiv - Bioengineering 2020Quote: ... the membrane was incubated with freshly prepared primary antibody solution (1:1,000 dilution for anti-Alix [ab117600, Abcam], anti-Tsg101 [ab30871, Abcam], anti-Calnexin [ab22595, Abcam], anti-His [34660, Qiagen] ...
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was isolated from log-phase bacterial cells grown in the rat peritoneal cavity or in 2.5% NaCl HI broth using the RNeasy minikit (Qiagen). One microgram of purified RNA was converted into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... Culture medium was harvested 72 h post-transfection and secreted His-tagged proteins purified using Ni-NTA agarose (Qiagen) in batch mode ...
-
bioRxiv - Neuroscience 2023Quote: ... The filtrated supernatant containing His-thioredoxin-ApoE was applied to a 5 ml Ni-NTA Superflow Cartridge (Qiagen, Germany) pre-equilibrated with TBS buffer A ...
-
bioRxiv - Plant Biology 2023Quote: ... The His and GST tag were cleaved by the Tev protease and separated from AtPAXXL228E using Ni-NTA (Qiagen). AtPAXXL228E was loaded onto a HiTrap Q HP column equilibrated with 20 mM Tris pH7.4 ...
-
bioRxiv - Genomics 2023Quote: ... we first extracted nuclei from fresh leaves and then prepared libraries using the EpiTect Hi-C Kit (Qiagen, Netherlands). HiC libraries were sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... the soluble fraction containing the His-VitR protein was purified using NTA-resin affinity chromatography in phosphate buffer according to manufacturer’s recommendations (Qiagen). After concentration (Vivaspin 6 Concentrator ...
-
bioRxiv - Biochemistry 2023Quote: ... The filtrated supernatant containing His-tagged NanoLuc was applied to a 5-mL Ni-NTA Superflow Cartridge (Qiagen, Germany) pre-equilibrated with TBS buffer A ...
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was collected and subjected to affinity purification using 5 mL Hi-Trap column containing Ni-NTA resin (Qiagen) on an AKTA Pure 25L protein purification system (GE Healthcare) ...
-
bioRxiv - Biophysics 2021Quote: ... PNGase F and the cleaved 10 × His tag were removed by passing the sample through Ni-NTA superflow resin (QIAGEN). The receptor was concentrated to 20–30 mg/ml with a 100 kDa cut-off concentrator (Millipore) ...
-
bioRxiv - Biophysics 2021Quote: ... NF-κB molecules were immobilized through the 6xHis-tag on the C-terminus of RelA by penta-His antibody biotin conjugate (34440, Qiagen). For DNA-bound NF-κB experiments ...
-
bioRxiv - Molecular Biology 2022Quote: His-tagged G5845–1508 (His-G5845–1508) (4 pmol) were coupled to Ni-agarose resin (25 μl of beads suspension) (Qiagen) during 1 h ...