Labshake search
Citations for Qiagen :
251 - 300 of 1445 citations for Dengue Virus Serotype 3 DIII envelope protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2022Quote: Whole tissue protein was extracted by Qproteome Mammalian Protein Prep Kit (Qiagen, 37901) according to the manufacture’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protein were extracted using the AllPrep DNA/RNA/Protein kit (Qiagen, #47054). Sample concentrations were measured with Qubit high sensitivity dsDNA and RNA platform ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated by adding 100 μL of a protein precipitation solution (Qiagen). Samples were centrifuged for 5 min at 13000 rpm ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA from epididymis white adipose tissue of wide type control mice (n=3) and miR-802 KI mice (n=3) was isolated using the RNeasy mini kit (Qiagen) following the protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was obtained and amplified in a first-round PCR (RdRpS1 5’-GGKTGGGAYTAYCCKAARTG-3’, RdRpR1 5’-TGYTGTSWRCARAAYTCRTG-3’) using One-Step RT-PCR Enzyme MixKit (Qiagen) with the total expected size of 602 base pairs (bp) ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Cell Biology 2024Quote: ... target sequence 5’-TTGCTTGGAGGCTACTCCCAA-3’) and control non-silencing scrambled siRNA (siSCR, target sequence 5’-AATTCTCCGAACGTGTCACGT-3’) were obtained from Qiagen. MAPK15-specific siRNA #2 (siMAPK15 #2 ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA isolation from Tbx4-CKO (n = 3) and Tbx4fl/fl (n = 3) lungs was performed using the RNeasy Mini Kit (Qiagen). The changes in gene expression were investigated by quantitative reverse transcription polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Genomics 2020Quote: ... Protein was precipitated by adding 200 µL of ice-cold Protein Precipitation Solution (Qiagen), gentle mixing and incubation on ice for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
bioRxiv - Neuroscience 2020Quote: ... Total protein was extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen #80004) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total protein was purified by the AllPrep DNA/RNA/Protein Mini Kit (Qiagen: # 80004). Corresponding protein expression levels in the cells of different groups were detected by western blot using the following antibodies ...
-
bioRxiv - Cell Biology 2023Quote: Cells were harvested for total protein using a Qproteome Mammalian Protein Prep Kit (Qiagen). Total protein was quantified using a PierceTM BCA Protein Assay Kit (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein Precipitation Solution (Qiagen #158910), DNA Hydration Solution (Qiagen #158914 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 333µl Protein Precipitation Solution (Qiagen) was added and samples were vortexed vigorously for 20 seconds at high speed ...
-
bioRxiv - Biochemistry 2024Quote: ... and Protein Complex suites (Qiagen). The sitting-drop vapor diffusion method was employed ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acid was extracted from 200 μl of each sample using the QIAamp MiniElute™ Virus Spin Kit nucleic acid (for DNA and RNA) according to the manufacturer (QIAgen Canada, Toronto, ON, Canada). DNA samples were stored at −80°C and assayed in duplicate by qPCR ...
-
bioRxiv - Neuroscience 2024Quote: DNA was extracted from the supernatant and the astrocyte cells after co-culture with T cells at 72 hours (QIAGEN QIAamp MinElute Virus Spin Kit) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein was extracted 48 hours post transfection with All Prep RNA/Protein Kit (Qiagen, USA). Protein concentrations were determined by Lowry assay (Bio-Rad ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... protein extraction was performed using the Allprep RNA/Protein Kit (80404 Qiagen Inc., Hilden, Germany). Proteins (10–20 µg ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was isolated from powdered tissues using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). Protein pellets were lysed in HES-SDS buffer (20 mM HEPES [pH 7.4] ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged proteins were purified using the QIAexpress Ni-NTA Protein Purification System (Qiagen) with 0.1 M ...