Labshake search
Citations for Qiagen :
251 - 300 of 2118 citations for 6 tert Butyl 4 chlorothieno 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 6 and 9 hours of treatment using RNeasy Plus Mini Kit (Qiagen, 74134), and was reverse-transcribed to cDNA using Transcriptor First Strand cDNA Synthesis Kit with random primers (Roche ...
-
bioRxiv - Genetics 2019Quote: Raw sequence files (FASTQ) were imported into CLC Genomics Workbench (v.6; Qiagen) and mapped onto the human genome (GRCh37/hg19) ...
-
bioRxiv - Biophysics 2020Quote: ... The studies were carried out on a Rotor-Gene Q 6 plex (QIAGEN) instrument at a heating rate of 2 °C/min and a temperature range of 25-90 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 6 dpf larvae (RNeasy Plus Mini Kit; Qiagen) and reversed transcribed (iScript Reverse Transcription Supermix ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RPR2 (n=6) primary tumors was performed using RNeasy Mini Kit (Qiagen) with the standard protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The 6 PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) to eliminate byproducts.
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 6-well plates using miRNeasy Mini Kits (QIAGEN 217004) with the inclusion of an on-column DNase digestion (QIAGEN 79254) ...
-
bioRxiv - Neuroscience 2024Quote: ... and the mouse hippocampal tissues (n=5-6/group; Qiagen, Germantown, MD, USA). The samples of the RNA (500ng/µL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Plant Biology 2020Quote: Reduced His-tagged PRX-IIE (3 mg) or PRX-IIE C146S (3 mg) were bound to 1 mL Ni-NTA resin (Qiagen, Hilden, Germany) and used as affinity matrix ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... using 3-mm steel beads (Cat No.: 69997, Qiagen); tubes were shaken for 20-s at 28 Hz with dry ice.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two sterile 3 mm beads (Qiagen, Hilden, Germany) and a bead device at 20 Hz for 3 min ...
-
bioRxiv - Immunology 2020Quote: ... and prepared the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). 10ng purified RNA was used for the NGS libraries ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in 3 volumes RLT buffer (Qiagen) and RNA was extracted using Dynabeads MyOne Silane (Life technologies) ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
bioRxiv - Genomics 2021Quote: ... 3 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template containing cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Molecular Biology 2023Quote: ... for 3 min in TissueLyser II (30 Hz; Qiagen). Cell lysates were centrifuged for 15 min (4 °C ...
-
bioRxiv - Immunology 2023Quote: ... using tungsten carbide beads (3 mm, Qiagen catalog #69997) and shaking (300 times per min ...
-
bioRxiv - Physiology 2023Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). Lysates were centrifuged for 15 min (21,000 g ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 µl of cell extracts ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Cell Biology 2024Quote: Cells were washed once with D-PBS and lysed using QIAzol reagent (QIAGEN). Total RNA was extracted using the Direct-zol RNA Miniprep kit (Zymo Research) ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: SUZ12 isogenic M3 MPNST cells were treated with or without DNMT inhibitors (50 nM daily Decitabine or 4 μM single dose of GSK862) for 4 days followed by genomic DNA isolation with Gentra Puregene cell kit (Qiagen). Bisulfite sequencing was conducted by the IGO core facility at MSKCC ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from infected (n = 4) and control (n = 4) bAM samples using the RNeasy Plus Mini Kit (Qiagen) as previously described [91] ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Molecular Biology 2021Quote: ... or 6 µM and harvested 24 h later by adding RLT lysis buffer (Qiagen). Similarly ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue from 6 brains were pooled to prepare total RNA (RNEasy micro kit, Qiagen) for reverse transcription and amplification to cDNA (Ovation Pico WTA kit ...