Labshake search
Citations for Qiagen :
251 - 300 of 4884 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: Second-round PCR products were purified with PCR purification columns (Qiagen) and quantified by 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplified library was purified using PCR cleanup columns (Qiagen #28206) and quantified for PE-150bp sequencing (Novogene).
-
bioRxiv - Genetics 2023Quote: Amplified DNA was PCR-purified using QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s protocol and prepared for Sanger sequencing using the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: The PCR amplicons were purified using a PCR purification kit (Qiagen). This PCR amplicon was fused with Kozak 3XHA (~100 bps ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR product was purified using a PCR purification kit (Qiagen) according to the manufacturer’s instructions and quantified with a 2100 Agilent Bioanalyzer ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR product was then purified using PCR Purification Kit (Qiagen). The concentration of DNA was measured using Quant-iT Picogreen Assay (Thermofisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... The PCR products were purified using QIAquick PCR Purification Kit (Qiagen). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified using QIAquick PCR Purification Kit (Qiagen, 28104). DNA library preparations ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was PCR-purified using Qiagen PCR purification kit (Qiagen, #28106). The amplified fragments and the pcDNA5/FRT/TO vector were then digested with the enzymes listed in the names of primers in the table above ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were purified using the QIAquick PCR purification kit (Qiagen) according to manufacturer’s protocol and submitted with corresponding sequencing primers for Sanger sequencing to confirm target modifications using the TIDE algorithm ...
-
bioRxiv - Cancer Biology 2023Quote: ... Resulting PCR products were purified using MinElute PCR Purification Kit (Qiagen) and submitted for Illumina sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... All the PCR products were purified (MinElute PCR purification Kit, QIAGEN) and digested with NotI (New England BioLabs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR-amplified templates were purified (QIAquick PCR purification kit, Qiagen #28106) and verified for the presence of a single DNA band of the expected size on a 1% TAE-agarose gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified with QIAquick PCR purification kit (Qiagen, #28106), followed by gel-purification using QIAquick gel extraction kit (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were cleaned via MinElute PCR Purification Kit (28004, Qiagen) and eluted in ultrapure water ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were cleaned with the MinElute PCR Purification kit (Qiagen). All culture blanks (without diatom cell ...
-
bioRxiv - Microbiology 2024Quote: ... PCR purified with the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and re-ligated using the Quick Ligation Kit (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were purified using a PCR purification kit (Qiagen) and inserted into the pBOMB4-Tet (-GFP ...
-
bioRxiv - Immunology 2024Quote: ... PCR products were purified using a QIAQuick PCR purification kit (QIAGEN) and sent for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR product was purified using QIAquick PCR Purification Kit (Qiagen), and then further amplified for 7 cycles in the second round of PCR containing 40 ng dsDNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products were purified using the MinElute PCR Purification Kit (Qiagen) and in vitro transcribed to produce antisense RNA-probes using the DIG Probe Synthesis Kit (Roche) ...
-
bioRxiv - Immunology 2024Quote: ... PCR products were purified with the MinElute PCR Purification Kit (Qiagen). Cloning was performed with the TOPO TA Cloning & Bacterial Transformation kit (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified with a QIAquick PCR purification kit (Qiagen) and size-selected one last time with an E-Gel SizeSelect II 2% ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified with a QIAquick PCR Purification kit (Qiagen), molarity was assessed with the Agilent 2100 and samples were sequenced on the Illumina NextSeq550.
-
bioRxiv - Cancer Biology 2024Quote: ... Second-round PCR products were purified with PCR purification columns (Qiagen) and quantified by 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: ... the amplified products were either PCR purified (Qiagen PCR Cleanup kit), or gel extracted using the Qiaquick gel extraction kit (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were then purified using QIAquick PCR purification kit (Qiagen). The DNA libraries were then sequenced using the Illumina NovaSeq 6000 SP platform.
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR product was cleaned using QIAquick PCR Purification Kit (Qiagen) and ligated into pCDNA3 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were purified using a PCR purification kit (Qiagen) and Sanger-sequenced to verify their identity ...
-
bioRxiv - Immunology 2024Quote: ... The TSDR was PCR-amplified using the AllTaq PCR Kit (Qiagen) using forward (AGAAATTTGTGGGGTGGGGTAT ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR products were purified using a QIAquick PCR Purification Kit (Qiagen). Unique barcode adapters were annealed to each sample ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR purification was performed with the QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: PCR products were purified using QIAquick PCR purification kit (Qiagen, 28104). The purified product was used as a template for T7 in vitro transcription (HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were purified using QIAquick PCR purification columns (28106, Qiagen) and loaded on 20% TBE gels (EC63155BOX ...
-
bioRxiv - Cell Biology 2024Quote: PCR product was purified using the QIAquick PCR Purification Kit (QIAGEN) following the standard protocol ...
-
bioRxiv - Cell Biology 2024Quote: PCR products were purified using Qiaquick PCR purification kit (QIAGEN #28104) and A-tailed by mixing 3 µl PCR product + 1 µl 10x Thermopol buffer (NEB M0267S ...
-
bioRxiv - Genetics 2024Quote: ... Resulting PCR amplicons were purified over MinElute PCR Purification columns (Qiagen) using the recommended protocol and visualized on E-gel EX 2% Agarose gels (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... We purified the resulting PCR product (QiaQuick PCR Purification Kit, Qiagen) and double-digested it using NotI-HF and BamHI-HF (rCutSmart buffer ...
-
bioRxiv - Genetics 2024Quote: ... The PCR products were purified using QIAquick PCR Purification Kit (Qiagen), and Sanger sequencing and NGS amplicon sequencing was performed through service provided by CCIB DNA Core Facility at Massachusetts General Hospital ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription-PCR (RT-PCR) was carried out with total RNA using the one-step RT-PCR kit (QIAGEN) according to the supplier’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real time PCR (qRT-PCR) analyses were performed with the QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol using gene specific primers (Supplementary Table S3) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR libraries generated from the second PCR were pooled and purified using QIAquick PCR purification kit (Qiagen, Catalog #28106). Samples were diluted to a final concentration of ~2 nM after they were quantified using the Qubit dsDNA HS Assay kit (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... The PCR reaction was subject to a PCR clean up with the QIAquick PCR Purification Kit (Qiagen, catalog # 28104). The concentration of purified ...
-
Huge and variable diversity of episymbiotic CPR bacteria and DPANN archaea in groundwater ecosystemsbioRxiv - Microbiology 2020Quote: ... solution C1 (Qiagen DNAeasy PowerSoil Kit) was added to the Powerbead solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3.5 μL of Q-solution (Qiagen), 1.5 μL of RNase-free water (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... 50 μl proteinase K solution (Qiagen), and 50 μl 1M dithiothreitol (DTT) ...
-
bioRxiv - Developmental Biology 2020Quote: Flexitube Gene Solutions siRNA mixtures (Qiagen) were utilized to knockdown the indicated target ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL Protein Precipitation Solution (QIAGEN) was added ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 10µl 5x Q-solution (Qiagen). Primers used for the respective vectors are listed in Supplementary Table 4 ...