Labshake search
Citations for Qiagen :
251 - 300 of 2242 citations for 4R 5S 2 5 Fluoropyridin 2 yl 4 5 diphenyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5×105 cells were lysed in RLT buffer (QIAGEN) with 10 μL of β-mercaptoethanol ...
-
bioRxiv - Microbiology 2024Quote: Stainless steel beads (5 mm, Qiagen, Cat no. 69989) and 2.0 ml bead-beating tubes (Olympus Plastics ...
-
bioRxiv - Neuroscience 2024Quote: ... and a 5 mm stainless steel bead (Qiagen #69989) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... and a 5 mm stainless steel bead (Qiagen #69989) in an RNase-free microcentrifuge tube ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we suspended 5 uL of MagAttract beads (Qiagen 1026901) in 55 µL of DNA plus TE Buffer (10 mM TRIS ...
-
bioRxiv - Genomics 2024Quote: ... using one stainless steel bead of 5 mm (Qiagen cat ...
-
bioRxiv - Cell Biology 2024Quote: ... each containing a 5 mm stainless steel bead (Qiagen) and lysed using a Qiagen TissueLyser II (30 Hz ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we suspended 5 uL of MagAttract beads (Qiagen 1026901) in 55 µL of DNA plus TE Buffer (10 mM TRIS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Those included UniSpike 2 and 4 from the QIAGEN RNA Spike-In Kit (Cat. No.: 339390, QIAGEN, Hilden, Germany), which were used to monitor RNA isolation efficacy ...
-
bioRxiv - Microbiology 2022Quote: ... depletion was performed during library preparation using three probes from QIAGEN FastSelect rRNA 5S/16S/23S Kit (Qiagen, Hilden, Germany), respectively ...
-
bioRxiv - Systems Biology 2023Quote: ... using the QIAseq FastSelect -5S/16S/23S kit (Qiagen). The transcriptomic reads were mapped to the combined sequence of the host genome and expression plasmid sequence by following the Modulome workflow (https://github.com/avsastry/modulome-workflow ...
-
bioRxiv - Cancer Biology 2021Quote: ... a 19-mer SPRY2 target sequence (5′-AACACCAATGAGTACACAGAG-3) (QIAGEN) was used and for the control a 19-mer NSi control sequence (QIAGEN ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Wells contained 5 μl/well TCL-buffer (QIAGEN, cat. 1031576) with 1% 2-Mercaptoethanol ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.12 units of Taq DNA polymerase (Qiagen, 5 units/μL) and 14.44 μL of ultra-pure water ...
-
bioRxiv - Microbiology 2021Quote: ... was added to a column (Qiagen, 5 mL polypropylene column), equilibrated with lysis buffer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Homogenates were centrifuged at 16,000 g for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and 5 mm stainless steel beads (Qiagen, Cat No. 69989) and briefly centrifuged ...
-
bioRxiv - Microbiology 2020Quote: ... 5) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) with modifications ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Insoluble debris was pelleted by centrifugation ...
-
bioRxiv - Cancer Biology 2024Quote: ... along with a pre-chilled 5-mm steel bead (QIAGEN). All samples were then placed in pre-chilled cassettes for the Tissue Lyser II and pulverized for at 30 1/s for three 1-minute oscillations ...
-
bioRxiv - Microbiology 2023Quote: ... with two 5-minute cycles on a TissueLyser II (Qiagen) separated by a 5-minute incubation on ice ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mL erythrocyte lysis buffer (EL buffer, Qiagen, Hilden, Germany) was added and PMNs were centrifuged ...
-
bioRxiv - Biochemistry 2024Quote: ... a 5 mL Ni2+-NTA HisTrap fast flow column (Qiagen) was equilibrated with 10 mL of buffer containing 20 mM Tris HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... After adding one 5 mm stainless steel bead (Qiagen #69989), the microtube was placed in a TissueLyser II (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... and 5 µL of QIAGEN Multiplex PCR Master Mix (Qiagen). The thermal profiles used were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: A total of 600 μL (three × 200 μL) of day 4 SARS-CoV-2 culture supernatant was used as input into the RNeasy Mini Kit (Qiagen) for RNA extraction with minor modifications ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Lysates were clarified by centrifugation at 24,000gat 4 °C for 20 min and passed through 2 ml of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Physiology 2024Quote: ... RNA was isolated from pooled vessels (4 renal arteries or 2 mesenteric arteries) using the RNeasy Micro kit (Qiagen, USA), quantified by the NanoDrop-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... was reverse transcribed at 37 °C for 2 h in a 20 μL reaction volume containing 4 U of Omniscript reverse transcriptase (Qiagen), 0.5 mM each dNTP ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was then cleared by centrifugation at 42,000 ξ g for 50 min at 4°C before being applied to 2 mL of Ni-NTA resin (QIAGEN) in a gravity flow column ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 µg/mL anti-Penta-His-Alexa Fluor 488 (Qiagen), which recognized the His-tag on PXDN-con4 ...
-
bioRxiv - Genomics 2020Quote: ... 5 mL nuclease-free water) instead of customary Elution Buffer (Qiagen) (see Supplementary Material Methods) ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.08 μl of 5 U/μl HotStarTaq DNA polymerase (Qiagen 203203) and 15.1 μl or 14.5 μl milliQ water ...
-
bioRxiv - Neuroscience 2022Quote: ... STHdh cells were transfected with FlexiTube siRNA (5 nmol) from Qiagen (Mm_Csnk2a2 ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and bead-bashed for 5 min at RT (Qiagen TissueLyser II). Lipid extracts were prepared using a modified version of the Bligh and Dyer lipid extraction [70] ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...