Labshake search
Citations for Qiagen :
251 - 300 of 1593 citations for 4 Nitro n propan 2 yl aniline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and digested DNA products were extracted from the agarose gel using the QIAquick Gel Extraction kit (QIAGEN, cat. n° 28704), according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted and purified from pooled scrambled control and genotyped cldn7b F0 knockout larvae (n=50 per group) at 7dpf using the RNeasy Plus Micro Kit (QIAGEN), followed by cDNA synthesis with the SuperScript IV VILO Master Mix Kit (ThermoFisher) ...
-
bioRxiv - Immunology 2021Quote: ... These plasmids were purified and DNA extracted using QIAGEN Plasmid Midi Kit (100) (cat. n° 12145, QIAGEN, Valencia, CA, USA), according to manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: E9.5 hindbrain spanning rhombomeres 1-6 were dissected from wild type and mutant embryos (n=3) to obtain total mRNA preparations (miRNeasy Micro Kit, Qiagen). Sequencing libraries were prepared following the SMART-Seq v4 Ultra Low Input RNA (TaKaRa ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 21 days following X-ray exposure we extracted the total RNA (RNeasy® mini kit, Qiagen, cat. n. 74104) from 3 sponges for each treatment and control ...
-
bioRxiv - Microbiology 2021Quote: ... coli giant spheroplasts we used a N-terminally 6-His tagged version of TcMscS cloned into the expression plasmid pQE80 (Qiagen) with restriction sites BamHI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant proteins were then separated from the His-tagged TEV protease (and the cut N-terminal portion) by gravity-flow separation on Ni-NTA agarose (Qiagen). Finally ...
-
bioRxiv - Genetics 2020Quote: ... The supernatant of the transfected cells encoding for N-HIS-FAM19A5 was collected for Ni-NTA affinity chromatography (Qiagen, Germany). Purified N-HIS-FAM19A5 was then digested overnight at 30°C with AcTEV protease (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... membranes were solubilized in 1.2% N-decyl-β-maltoside (DM) and the protein was purified on a Ni-NTA affinity column (Qiagen). Following His-tag removal ...
-
bioRxiv - Cell Biology 2022Quote: RNA was extracted from cryo-pulverized inguinal adipose tissue from freely-fed 14-day-old mice (n=3 male and female for PTPN23H/H and PTPN23+/+) using the RNeasy Mini Kit (74104; Qiagen) according to manufacturer’s instructions ...
-
Single-cell assessment of trophoblast stem cell-based organoids as human placenta-modeling platformsbioRxiv - Developmental Biology 2022Quote: ... The methylation status of each CpG of interest (n=6 per sample) was evaluated with PyroMark Q-CpG software (Qiagen) and data from all CpG sites was averaged for each sample and presented as percent methylation (Figure S1E).
-
bioRxiv - Genomics 2022Quote: Genomic DNA was extracted from all F2 individuals (n = 118) and their parental lines using the DNeasy Plant Mini Kit (Qiagen). The obtained DNA samples were digested with PstI and MspI to construct a double digest restriction-site associated DNA sequencing (ddRAD-Seq ...
-
bioRxiv - Biochemistry 2024Quote: The periplasmically located VC0430 that was used for ESI-MS analysis was purified by applying the clarified lysate to N-NTA resin (Qiagen), washing the resin with Wash Buffer (WB ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted in random order from the faecal slurries (n=484) using DNeasy PowerLyzer PowerSoil kit (Qiagen, 12855-100) and the V3-region of the 16S rRNA gene was PCR amplified using 0.2 µl Phusion High-Fidelity DNA polymerase (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Total RNA was isolated from untreated or RNP-transfected plerixafor-mobilized HD and SCD HSPCs (n=3 for each group) using the RNeasy Kit (QIAGEN) that includes a DNAse treatment step ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was extracted from paired ovaries (N=6 per condition) using a miRNeasy micro extraction kit per the manufacturer’s instructions (Qiagen, 217084). RNA concentration and quality were assessed using the RNA Total RNA Nano Assay (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA (gDNA) was extracted from all samples using the QIAGEN DNEasy Plant Mini Kit (Qiagen N. V., Hilden, Germany) following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: We extracted total RNA from liver and BAT from each sample (n = ∼6 per genotype/sex/treatment/tissue) using the RNeasy PowerLyzer Kit (QIAGEN). We generated Illumina cDNA libraries from 1 μg of purified RNA using KAPA Stranded mRNA-Seq Kit (Illumina) ...
-
bioRxiv - Physiology 2023Quote: DNA was extracted from fecal pellets (100 mg, n=5 per group) by the QIAmp Power Fecal DNA kit (12850-50, Qiagen). The V4 region of 16S rRNA gene was amplified ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from Day 11 populations (n=20, 5/treatment) using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Germany) adapted from the manufacturer’s instructions to include a lysostaphin lysis step(50) ...
-
bioRxiv - Neuroscience 2024Quote: Isolated dorsal striatal microglia (n = 5-7 per condition) were centrifuged for 5 min at 600xg and resuspended in RLT plus buffer (Qiagen) for extraction and purification of total RNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... meioc cDNA encoding 356 amino acid residues from N-terminus and ythdc2 cDNA encoding amino acid residue Arg743 to Leu1381 were cloned into a pQE-30 vector (QIAGEN) and a pET-21a (+ ...
-
bioRxiv - Microbiology 2024Quote: ... were prepared from each rumen digesta sample (n=24) as follows: samples were homogenized to a fine powder using a tissue lyser (Qiagen). Approximately five volumes of 70% ethanol were added ...
-
bioRxiv - Genomics 2024Quote: ... and the samples from the Democratic Republic of Congo (n = 1) were processed using the QIAsymphony DSP Virus/Pathogen Kit (QIAGEN) with modifications ...
-
bioRxiv - Biochemistry 2024Quote: ... laevis STK19 variants expressed with a PreScission protease cleavable N-terminal His6 tag were purified using Ni-NTA Superflow resin (Qiagen) equilibrated in STK19 NiNTA Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted and 5 μg reverse transcribed from paired isolated Jz and Lz placental tissues (n = 8-10 per genotype/sex, across 11 litters) using the RNeasy Plus Mini Kit (Qiagen, DE) and the High-Capacity cDNA Reverse Transcription Kit minus RT inhibitor (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from batches of embryos, ICM or TE (n = 20) using PicoPur Arcturus (Excilone, France) with a DNase I (Qiagen, Germany) treatment as recommended by the supplier ...