Labshake search
Citations for Qiagen :
251 - 300 of 744 citations for 4 4' Bi 7H benz de anthracene 7 7' dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 4 °C and the supernatant was loaded onto a NiNTA column (Qiagen, Hilden, Germany) previously equilibrated with washing buffer (20 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2024Quote: ... treatment or remission serums (n = 4 repeats/condition) using the RNEasy plus kit (Qiagen). Libraries were generated with the KAPA mRNA HyperPrep Kit (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... Reads were assembled with CLC Genomics Workbench v12.0.3 software de novo pipeline (QIAGEN). Consensus sequence was called and manually corrected also within CLC Genomics Workbench ...
-
bioRxiv - Cell Biology 2020Quote: ... The solution was then incubated overnight with Ni-NTA agarose (Qiagen, Hilden, DE) at 4°C ...
-
bioRxiv - Physiology 2023Quote: RNA was harvested with 100 µL of QIAzol Lysis Reagent (Qiagen, Hilden, DE) per well of an MEA plate ...
-
bioRxiv - Microbiology 2024Quote: ... De novo assemblies were created using CLC Genomics Workbench v21 (Qiagen, Hilden, Germany) with default parameters ...
-
bioRxiv - Microbiology 2024Quote: ... The De Novo Assemble Long Reads tool of CLC Genomics Workbench v22.0 (Qiagen) was used with default parameters to assemble the genomes.
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Genomics 2020Quote: Testis tissue was homogenized at 4°C in 1ml QIAzol Lysis Reagent (Qiagen, Hilden, Germany) together with RNase-Free Zirconium Oxide Beads (NextAdvance ...
-
bioRxiv - Biophysics 2020Quote: ... 4 °C) and the supernatant was then incubated with 200 µl Ni-NTA (#30230, Qiagen) beads for 1 hour at 4 °C ...
-
bioRxiv - Genomics 2020Quote: ... 4 μl of pooled products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The soluble cell lysate fraction was loaded on a 4 mL Ni-NTA column (QIAGEN) pre-equilibrated with binding buffer ...
-
bioRxiv - Physiology 2021Quote: Total RNA was purified from embryos at 4 dpf using an RNeasy micro kit (Qiagen) with DNase I ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... we used 4 columns to purify product following the MinElute PCR Purification Kit manual (Qiagen). DNA from each column was eluate using 25 μL EB buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Clarified lysate was then incubated for one hour at 4 °C with Ni-NTA (Qiagen) in batch adsorption format ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Bioengineering 2022Quote: ... 350 µL of NucleoSpin RNA extraction buffer along with 4-5 ceramic beads (Qiagen 13113) were added 14into the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... 30 cycles) and the 170bp band purified on a 4% agarose gel (Qiagen gel purification). Fragments were extended with homology arms (Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Plant Biology 2022Quote: Total plants RNA were extracted from 4 weeks plants using the RNeasy kit (Qiagen, Germany) and two micrograms of RNA was reverse-transcribed using SuperScript IVTM Reverse Transcriptase according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatant was added to a gravity column containing 4 mL of Ni-NTA (Qiagen). Beads were washed with a high salt buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... to which 4 μL of RNase A (100 mg/mL) was added (Qiagen, Germantown MD). The cell lysate was applied to a DNeasy Mini spin column ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μl of siRNAs were mixed with 37.5 μl of Hiperfect transfection reagent (301707, Qiagen) and enough Optimem Opti-MEM reduced serum medium (31985070 ...
-
bioRxiv - Immunology 2024Quote: ... organ parts collected as described above were homogenized by TissueLyser II (Qiagen, 25Hz, 4 min) and centrifuged to remove debris ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned with the UltraClean 96 PCR Cleanup kit (Qiagen, Cat. #12596-4) and pooled using the same volume for each sample ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluent was then incubated overnight at 4°C with Ni-NTA beads (Qiagen, 36111), which were subsequently collected ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or from whole fecal pellets using a DNeasy PowerSoil HTP 96 kit (Qiagen 12955-4). Library preparation and sequencing was performed at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Cell Biology 2024Quote: ... Larval DNA was extracted with the MagAttract PowerSoil DNA EP Kit (Qiagen, 27100-4-EP). Following the Earth Microbiome Project protocol (http://www.earthmicrobiome.org/) ...
-
bioRxiv - Plant Biology 2024Quote: ... 4-5 leaf pieces from clip-inoculated samples) using RNeasy Plant Mini Kit (Qiagen, Germany). Depending on the RNA concentration ...
-
bioRxiv - Microbiology 2024Quote: ... and Fcwf-4 cells using an RNeasy Mini Kit (QIAGEN, Chuo-ku, Japan, Cat# 74104) and QIAshredder (QIAGEN ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from leaf 4 using the RNeasy Plant Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... steps were carried out at 4°C centrifuge as described previously using RNeasy kit (Qiagen) [84] ...
-
bioRxiv - Developmental Biology 2024Quote: ... 15 mM DTT) and then treated with 2 μL of 4 mg/mL Protease (QIAGEN) by incubation at 55°C for 6 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tagmented DNA was purified using the Minelute Cleanup Kit (Qiagen, Hilden, DE, Cat #28004). DNA was amplified with 12 cycles of PCR using the NebNext Hi-Fi 2X PCR Master Mix (New England Biolabs Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... the samples were de-crosslinked and purified using a QIAquick PCR purification kit (Qiagen) and analysed using a qPCR.
-
bioRxiv - Microbiology 2022Quote: ... Reads were processed and de novo assembled using the CLC Genomics Workbench software (Qiagen). Assembled genomes were annotated using the RAST annotation pipeline and GeneMarkS (63 ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated using the QuantiTect reverse transcription kit with gDNA Wipeout (Qiagen, DE). Conventional PCR amplification of Gpr116 was achieved using the forward primer 5’ TCCAATTCGAGGGACCGAAG 3’ and reverse primer 5’ GTAGTTCACAACCACGCTGC 3’ ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Multipex PCR Kits used for MASC PCR were purchased from QIAGEN (Hilden, NRW, DE). Plasmids were extracted using Omega E.Z.N.A DNA Isolation Kit (Omega Bio-Tek ...
-
bioRxiv - Neuroscience 2021Quote: ... and the RNA was isolated using a RNeasy Plus Micro Kit (Qiagen, Düsseldorf, DE) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted by the RNeasy Mini kit from QIAGEN (74104, Hilden, DE). The library preparation and sequencing were performed by Eurofins Genomics (Tokyo ...
-
bioRxiv - Cancer Biology 2024Quote: ... while RNA was extracted from intestinal organoids using the RNeasy Mini Kit (Qiagen, DE). For cDNA synthesis ...
-
bioRxiv - Cancer Biology 2024Quote: ... De-crosslinked DNA and input was purified using a PCR purification kit (QIAGEN, 28106). The immunoprecipitated samples along with input were analyzed by q-RT PCR using KAPA SYBR® FAST (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...