Labshake search
Citations for Qiagen :
251 - 300 of 3877 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Molecular Biology 2020Quote: ... After 14 h binding to 4 mL Ni-NTA agarose beads (Qiagen), the beads were first washed with 15 mL Ni-NTA binding buffer and then with 15 mL Ni-NTA wash buffer (1 M NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 µL of DNA) and run in Rotor-Gene Q machine (QIAGEN). Primer sequences are listed in the table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Sample supernatants were incubated with 4 mL of Ni-NTA Agarose (Qiagen) for >1 hour at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Microbiology 2022Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Genomics 2022Quote: ... and 4 µl of 100 mg/ml RNase A (QIAGEN, cat# 19101) were added to the homogenate ...
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl of DNA) and run in Rotor-Gene Q machine (Qiagen). Primer sequences are listed in the Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Removed culture was mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) for stabilization and incubated for 5 min at room temperature before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... with 4 × 108 copies of cel-miR-39 miRNA mimic (Qiagen 339390) spiked into to the sample after addition of lysis buffer.
-
bioRxiv - Neuroscience 2023Quote: ... At least 4 colonies were used for each DNA miniprep (QIAprep, Qiagen) and mutations were confirmed by Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... The siRNAs were selected from the FlexiTube GeneSolution 4 siRNA sets (Qiagen) and transfected as a mix at 24 nM in Calu-3 and 10 nM in Caco-2 following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7.5 at 4°C) and purified using the RNAeasy kit (Qiagen).
-
bioRxiv - Immunology 2024Quote: ... and 4 weeks post-transduction using the DNeasy Blood & Tissue kit (Qiagen). Genomic DNA was also extracted from HEK293T cells used for lentiviral production to confirm baseline sgRNA frequencies ...
-
bioRxiv - Cancer Biology 2024Quote: ... TagLuc non-expressing clone 4 cells using the RNeasy Mini Kit (Qiagen). 1 μg was reverse-transcribed using an oligo-dT primer and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which we select the top 250 genes for which the correlation coefficient was positive and the top 250 genes for which the correlation coefficient was negative. The final step of the pipeline (Fig. 1 (4)) analyzes these genes by using Ingenuity Pathway Analysis (IPA, QIAGEN, [27]) to interpret the canonical pathways.
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... thresholds were used to prepare Reduced Representation Bisulfite Sequencing (RRBS) libraries using the Ovation RRBS Methyl-Seq System 1-16 (NuGen) and the EpiTect Fast DNA Bisulfite kit (Qiagen). Libraries were sequenced using the NextSeq500 platform (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... Clarified lysate was mixed with Ni-NTA agarose at 4℃ for 2h (Qiagen). Bound protein was eluted in 20 mM Tris pH 8.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lysates were treated with 4 μl of 100 mg/ml RNase A (QIAGEN) at 37 °C shaking at 500 RPM for 3 hours ...
-
bioRxiv - Immunology 2021Quote: ... and kept at 4°C RNA was purified using RNEASY Mini Kit (Qiagen) and its concentration determined using a Nanodrop 1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C for 10 min and the pellet was lysed with RLT+ (Qiagen). For scRNA-sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... at 4°C until RNA was extracted using the RNeasy Mini Kit (Qiagen)
-
bioRxiv - Microbiology 2020Quote: The MoBio PowerSoil-htp 96 kit (now Qiagen Cat No./Id: 12955-4), with minor modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell pellets were lysed in a 4% SDS buffer using a Qiashredder (Qiagen). Relative densitometry for western blots was determined using ImageJ software and normalized to the density of loading control β-ACTIN ...
-
bioRxiv - Microbiology 2021Quote: ... into a volume of 4 μL PBS sc 1X (Qiagen, Cat. No. 150345). To avoid evaporation of the PBS sc 1X during the sort ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL of room temperature Stop solution (REPLI-g Single Cell Kit, Qiagen) was then added and the samples were vortexed and spun down ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 18 µl of Omniscript enzyme at 4 U/µl (Omniscript RT Kit, Qiagen), and 37 µl water ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was incubated overnight at 4 °C with Strep-Tactin Beads (Qiagen), typically using 0.75 ml packed beads per two liters of original culture volume ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with dsHsc70-4 with the Effectene Transfection reagent (301427, QIAGEN) and incubated for 72 h ...
-
bioRxiv - Microbiology 2023Quote: ... supernatant was incubated overnight at 4°C with Ni-NTA agarose beads (Qiagen) used to purify the recombinant proteins as described [40] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Crystals were grown at 4 °C in EasyXtal-15-Well Tools plates (Qiagen), using hanging-drop vapour diffusion ...
-
bioRxiv - Neuroscience 2023Quote: Cultured cells were lysed at 4°C in RLT buffer (Qiagen, Courtabœuf, France) and stored at -80°C ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was isolated with the DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4). Library preparation and sequencing were performed at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Genomics 2024Quote: ... with 4 µl of RNase A (100 mg/ml) (Qiagen, Germantown, MD, USA), The extraction procedure was then followed by the manufacturer’s manual ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were harvested by scraping in 4 mL lysis buffer (RLT buffer (Qiagen) + 143 mM β-ME) ...
-
bioRxiv - Biochemistry 2024Quote: ... The soluble fraction was then added to 4 mL Ni-NTA beads (Qiagen) pre-washed in water ...
-
bioRxiv - Genetics 2024Quote: ... Samples were cooled and 4 µL 100 mg/mL RNAse A (Qiagen, #19101) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and damaged OA cartilage with a Mankin score of 4 or higher (n=1, female, 80 years old) using MiRNeasy Kit (Qiagen, Germantown, USA). RNA was quantified using the Nanodrop 1000 Spectrophotometer (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from cells treated for 48 h with 1 mM aspirin and 4 μM regorafenib using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen Cat# 80004) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4°C and the supernatant was loaded onto a 1 ml nickel nitrilotriacetic acid-agarose column (Ni-NTA, Qiagen, Hilden, Germany) previously equilibrated with the corresponding lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... were weighed and homogenized in 1-10 µL/mg DMEM with a sterile glass bead at 30 Hz for 4 minutes using a TissueLyser (Qiagen, Germantown, MD) automated homogenizer ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...