Labshake search
Citations for Qiagen :
251 - 300 of 2787 citations for 2S 4S 1 tert Butyl 2 methyl 4 hydroxypiperidine 1 2 dicarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... [2] or QIAzol® Lysis reagent (Qiagen, #cat 79306) following vendor’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... and 16.7% (v:v) Proteinase K (Qiagen, 19131, 2 mL). The suspension was then incubated at 37 ℃ for 15 minutes at 500 r.p.m.
-
bioRxiv - Microbiology 2024Quote: ... packed with 2 mL Ni-NTA agarose resin (Qiagen) pre-equilibrated with 15 mL lysis buffer ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL Ni-NTA resin (Qiagen, Cat. # 30210) was equilibrated with 10 mL of 1X Base buffer and 5 mM β-mercaptoethanol for 10 min by constantly rotating ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sample incubated with 2 NiNTA resin (Qiagen, USA). Protein samples were allowed to bind for 4 hr ...
-
bioRxiv - Systems Biology 2020Quote: ... was prepared by centrifuging a cell culture at 5525xg for 2 minutes at 4°C then resuspending cells in 1mL of PBS-RNAprotect (333 μL RNAprotect Bacteria Reagent [76506, Qiagen, Hilden, Germany], 666 μL PBS). For immediate RNA stabilization by RNAprotect (Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2 min at 40 Hz using TissueLyser LT (Qiagen). 500 µl PBS-tween (0.01% ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mL of nickel-charged resin (Qiagen, Ni-NTA Agarose) was added to a column (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... using the QIAstat-Dx Respiratory SARS-CoV-2 Panel (Qiagen). Viral stocks were produced infecting at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... in a 2 mL cryovial using a tissue lyser (Qiagen) and 0.2mm ceramic beads ...
-
bioRxiv - Microbiology 2021Quote: ... or using the QIAseq SARS-CoV-2 Primer Panel (Qiagen) (for organoid supernatants) ...
-
bioRxiv - Genomics 2021Quote: ... QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 333895) and QIAseq FX DNA Library Kit were used in order to prepare amplicon libraries for viral genome sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and extension by 2 × multiplex PCR master mix (QIAGEN, USA) at 72 °C for 30 s ...
-
bioRxiv - Biochemistry 2023Quote: ... then loaded on to 2 mL Ni-NTA column (Qiagen) pre-equilibrated with 10 column volumes of 50 mM Tris pH 7.5 containing 300 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... coverslips were treated with 2 mg/ml RNase A (QIAGEN) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... for 2×2min at 30Hz in a TissueLyser II (Qiagen). After homogenization ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pellets were thawed in 2 mL RLT lysis buffer (Qiagen) containing 10 μL mL-1 of 2-mercaptoethanol ...
-
bioRxiv - Immunology 2023Quote: ... following a 2-step VDJ amplification using HotStarTaq Plus (Qiagen). PCR products were enzymatically cleaned again and illumina adapters and indexes were introduced via PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a 48-sample holder (Tissue Lyser 2, Qiagen). The samples were treated with 1 ml pre-cooled (-20°C ...
-
bioRxiv - Genomics 2023Quote: ... using a TissueLyzer II (QIAGEN, 2min, 25 Hz, 2 times). The samples were incubated at room temperature for 5min ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNU6-2 (Hs_RNU6-2_11 miScript Primer Assay, Qiagen, MS00033740) as housekeeping miRNA.
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of HiPerfect transfection reagent (cat. no. 301705, Qiagen) were mixed with 100 μL NeuroBasal medium without supplements ...
-
bioRxiv - Microbiology 2023Quote: ... fitted with a 2 ml tube holder (Qiagen, Germantown, MD). RNA was purified with the ZymoBIOMICS RNA Miniprep kit (R2001 ...
-
bioRxiv - Genomics 2022Quote: ... and ‘Sy-2’ plants using Genomic Tip (Qiagen, Hilden, Germany), and high-molecular-weight DNA (fragment length > 40 kb ...
-
bioRxiv - Neuroscience 2022Quote: ... and IRS solution (Qiagen Cat No./ID: 26000-50-2) for a custom protocol ...
-
bioRxiv - Immunology 2024Quote: ... 2 million PBMC were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2021Quote: Isolated Tert+ and Tert-cells (≤ 5 cells) were subjected to synthesize the complementary DNA (cDNA) using REPLI-g WTA Single Cell Kit (QIAGEN) and analyzed for gene expression by qRT-PCR ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...