Labshake search
Citations for Qiagen :
251 - 300 of 3571 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... or if more than one band was present extracted from 1% TAE gel using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Nucleotide BLAST (BLASTn ...
-
bioRxiv - Microbiology 2023Quote: ... Tissues were thawed at the time of titration and homogenized for one minute at a frequency of 26 sec-1 in a TissueLyser (Qiagen, Haan, Germany) prior centrifugation for 5 minutes at 16,100xg to pellet debris ...
-
bioRxiv - Neuroscience 2020Quote: ... containing Protease inhibitor cocktail (PIC, Complete, 1:25) and lysed at 4°C using a TissueLyser LT (Qiagen) on 50 Hz for 2 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Microbiology 2020Quote: Each dissected compartment (legs and thoraxes) was homogenized individually 3 x 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Bioengineering 2023Quote: Each body part (legs and thorax) was homogenized individually for 3 × 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Immunology 2024Quote: Total RNA from roughly 1-3 million thawed patient PBMCs was extracted using a RNeasy Mini Extraction kit (Qiagen) and reverse transcribed to cDNA using oligo-DT primers and the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing DNase I (1 mg/ml, Qiagen) at 37 °C for 5 min with gentle shaking ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 ml of Proteinase K (Qiagen, 19131) was added to the tube and vortexed for 5 seconds ...
-
bioRxiv - Systems Biology 2022Quote: ... resuspended in 1 mL QIAzol reagent (Qiagen) and stored at -80 °C.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1) DNeasy PowerLyzer PowerSoil Kit (QIAGEN®), 2 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ni-NTA agarose beads (1 ml; Qiagen), washed and resuspended in loading buffer (50 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... 1-unit HotStarTaq Plus (QIAGEN, Cat#: 203607), 190 nM 3’ primer pool ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... 25 nM of S1PR1 #1 (Qiagen, #SI00376201) 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... stored in 1 ml RNAlater (Qiagen, Netherlands), and moved to a −20 °C freezer for up to a month until RNA was extracted ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 uL ∼1.07 AU/mL Protease (Qiagen) was added to each well and incubated at 37 °C for 40 min ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 25 mM MgCl2 (Qiagen) and 1 ul of the primer mix (40 uM of the Forward primer ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... containing 1 × Master Mix (Qiagen Multiplex Kit), 0.4 μg/μL of BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL RNAProtect Bacterial Reagent (Qiagen, #76506) was added to each sample and thawed on wet ice for 10 min ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Systems Biology 2024Quote: ... containing 1 mL of RNAProtect (Qiagen, 76506). The sorting rate was kept below 9000 events/s to minimize the false positive ratio and the flow rate was maintained at approximately 25-35 µL/min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 0.5 mg ml-1 proteinase K (Qiagen), 0.2 mg ml-1 RNase A (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 0.2 mg ml-1 RNase A (Qiagen) were added and incubated at 50°C for 2 hours until the solution became uniform and clear ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Physiology 2020Quote: ... insulin-like growth factor 1 receptor (Igf1r) and sirtuin 1 (Sirt1) gene promoters were designed using the Pyromark Assay Deisgn 2.0 software (Qiagen). PCR and sequencing primers are provided in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 10-day-old whole seedlings grown on 1/2X MS media containing 1% sucrose and 0.8% agar (Plant RNeasy kit (Qiagen)) ...
-
bioRxiv - Systems Biology 2023Quote: ... x mg solid matrix were mixed with five times the μl amount of ACN:water (1:1, v/v) and homogenised with a TissueLyser II (30 Hz, 10 min; Retsch Qiagen). After a short centrifugation (2 min ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Bioengineering 2020Quote: Around 250 mg of each produce sample was cut into 1-3 mm pieces using a scalpel and then processed with the DNeasy Powersoil Pro kit (Qiagen) to isolate 50μL of eluted DNA ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was purified 1-3 dpi from mock- or POWV-infected hBMECs or hPCs using RLT lysis buffer and RNeasy columns (Qiagen). Purified RNA was quantitated ...