Labshake search
Citations for Qiagen :
251 - 300 of 3862 citations for 2' Chloro 4 5 5 dimethyl 1 3 dioxan 2 yl butyrophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was the incubated at 4 °C with 2 ml of washed Ni-NTA agarose beads (Qiagen) for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were mechanically disrupted by bead-beating for 2 × 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). The samples were incubated at −80°C for 10 min and at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... using the QIAGEN TissueLyser at 15 Hz for 2-3 min with a Stainless-Steel Bead (QIAGEN catalog # 69989). Phase separation was induced with chloroform ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 3 g of each soil was mixed with 2 volumes of LifeGuard Soil Preservation Solution (Qiagen, Hilden, Germany) directly in the field ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Molecular Biology 2023Quote: Approximately 5 mg of frozen liver was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...
-
bioRxiv - Microbiology 2022Quote: ... Nasal turbinates and lungs were collected from a subset of hamsters at 4 dpi and homogenized in 1ml or 5 ml of PBS with TissueRuptor (Qiagen), respectively ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from the stomach and pyloric caeca tissue samples stored at -80 °C (n = 4 for control and fly larvae, n = 5 for shrimp shell) using the RNeasy Plus Universal Kit (QIAGEN). RNA quality was assessed using a 2100 Bioanalyzer with the RNA 6000 nano kit (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... and adult females (approximately 4-5 of each) were prepared for RNAseq using the RNeasy Blood and Tissue Kit (Qiagen). Individuals were placed in a 1.5 mL safelock tube along with 5-8 one mm glass beads placed in liquid nitrogen and then shaken for 30 s in a Silamat S6 shaker (Ivoclar Vivadent) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were pelleted at 350 x g for 5 min at 4 °C and lysed in 350 μl RLT buffer of the RNeasy Mini Kit (Qiagen). RNA was isolated according to the manufacturer’s instructions ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Lysates were cleared by centrifugation at 15000 x g for 30 min at 4 °C and incubated in Pierce 5 ml columns with Ni-NTA agarose beads (Qiagen) at 4 °C for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: mRNA was isolated from Boyden chamber migration assay-derived Treg pellets from 5 HD and 4 uRRMS patients using RNeasy micro kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Genomics 2024Quote: ... The pooled cells were centrifuged at 500 × g for 5 minutes at 4°C and resuspended in 100 μl of buffer EB (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Cell Biology 2024Quote: Hand SFs were transfected with 50 nM antisense LNA targeting HOXD10 (Qiagen, Sequence: 5′-TGT CTG CGC TAG GTG G-3′), HOXD11 (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an aliquot (5 µL) was treated with 0.5 µL of 5 mg/ml RNase A (QIAGEN, Hilden, Germany) at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Microbiology 2024Quote: ... using stainless steel beads (5 mm; Qiagen). RNA was then extracted using a RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Genetics 2023Quote: ... 5 ul of 5X Q-solution (Qiagen), 1 ul of 5 mM 7-deaza-dGTP (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAse A (5 μg/mL, Qiagen #19101) was added to the whole cell extracts (WCE ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.7 × 10−5 AU/mL protease (Qiagen), 1.0 μM barcoded oligodT-ISPCR primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mm diameter stainless steel bead (Qiagen) was added to all the tubes and the tissue was homogenised in TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stainless-steel beads (5 mm, Qiagen) before RNA isolation using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen ...