Labshake search
Citations for Qiagen :
251 - 300 of 2450 citations for 14 Nonylphenoxy 3 6 9 12 tetraoxatetradecan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Neuroscience 2024Quote: ... using a 3 mm bead (Qiagen 69997) and agitation with the Tissue Lyser II (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Neuroscience 2020Quote: ... from APP/PS1 and NTG mice treated with vehicle of CP2 for 14 months (n = 5 per group) were lysed in QIAzol (Qiagen cat. # 79306) followed by RNA isolation using miRNeasy (Qiagen cat ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was isolated from snap-frozen cortico-hippocampal brain sections from NTG and APP/PS1 mice treated with vehicle or CP2 (n = 5 per group) for 14 months using a DNeasy Blood & Tissue Kit (QIAGEN, cat. # 69504) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... We obtained single amplified products for12 out of the 14 PCR primer pairs and these amplified products were purified using the QIAquick PCR Purification Kit (28104, Qiagen, Germantown, MD) before sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... unexpanded leaves was extracted from 14 individuals (7 early-blooming, 5 late-blooming, and the two parents) with a DNeasy Mini Plant Kit (Qiagen, Hilden, Germany) and quantified with a Quant-iTTM PicoGreenTM dsDNA assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Spleens were harvested at indicated timepoints and homogenized in a 2ml homogenizer tube (Fisher Brand Cat. 14-666-315) containing 1ml sterile PBS and one 5mm stainless steel bead (QIAGEN Cat. 69989). For oral infection ...
-
bioRxiv - Bioengineering 2023Quote: Total RNA of osteogenically differentiated pre-osteoblasts at days 7 and 14 were extracted by RNeasy Plus Mini Kit (Qiagen Inc., USA). RT-qPCR was performed to confirm osteogenic gene expression levels by using TaqMan gene expression assays with the following probe/primer combinations ...
-
bioRxiv - Cancer Biology 2024Quote: Genome-wide methylation analysis was performed on 500 ng of DNA isolated from #14 human PM cell lines of different histotype using QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) by the Infinium Human Methylation EPIC 850k (EPIC ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 µl of diluted template cDNA (1:3, nuclease-free water) per real-time PCR reaction (10 µl – SYBR Green PCR kit, Qiagen, 204143) was used to assay specific transcript abundance (CFX96 Real-Time System ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from homogenized lysate containing a range of 3×103 to 1×105 cells per sample using a ll Prep DNA/RNA Mini kit (Qiagen, #80204). RNA was purified and concentrated using RNAClean XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: The RNA-seq raw fastq data was processed with CLC Genomics Workbench 12 (Qiagen). The Illumina sequencing adaptors were trimmed and reads were mapped to the HG38 human reference genome ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was collected from 12-24hr embryos per manufacturer’s specification (RNeasy kit, Qiagen). cDNA libraries were generated with the TruSeq stranded mRNA sample library kit (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... this results in approximately 1X coverage per female) using CLC Genomics Workbench 12 (Qiagen). Using the PoPoolation v1.2.2 pipeline (Kofler et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and fhaB encoding regions were performed using Qiagen CLC Genomics Workbench 12 (Qiagen, Germany). The list of all genes of interest has been provided in Supplementary Material.
-
bioRxiv - Bioengineering 2023Quote: ... hMSCs were seeded in 12-well plates and transfected with MALAT1 antisense probe (Qiagen) at a concentration of 50 nM (final concentration ...
-
bioRxiv - Microbiology 2023Quote: ... 12 µL were reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen), as described elsewhere (14) ...
-
bioRxiv - Genomics 2022Quote: ... and initial bioinformatics analyses were performed in the CLC Genomics Workbench (version 12) (Qiagen). All samples generated approximately 16 million reads ...
-
bioRxiv - Microbiology 2024Quote: ... Genome assembly and variant identification was performed using CLC Genomics Workbench 12 (Qiagen, Germany). Mutations were identified using the HaitiWT genome (50 ...
-
bioRxiv - Cell Biology 2020Quote: Data to derive different biological clocks was available for different subsamples and all based on a fasting blood draw from participants in the morning between 8:30 and 9:30 after which samples were stored in a −80°C freezer or – for RNA - transferred into PAXgene tubes (Qiagen, Valencia, California, USA) and stored at −20°C ...
-
bioRxiv - Genetics 2022Quote: ... and conventional extraction methods (n = 9) using a lysis buffer and purified using silica columns (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). All lysates were analyzed with a QubitTM 4 Fluorometer (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Immunology 2024Quote: Total RNA from epididymis white adipose tissue of wide type control mice (n=3) and miR-802 KI mice (n=3) was isolated using the RNeasy mini kit (Qiagen) following the protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was obtained and amplified in a first-round PCR (RdRpS1 5’-GGKTGGGAYTAYCCKAARTG-3’, RdRpR1 5’-TGYTGTSWRCARAAYTCRTG-3’) using One-Step RT-PCR Enzyme MixKit (Qiagen) with the total expected size of 602 base pairs (bp) ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Cell Biology 2024Quote: ... target sequence 5’-TTGCTTGGAGGCTACTCCCAA-3’) and control non-silencing scrambled siRNA (siSCR, target sequence 5’-AATTCTCCGAACGTGTCACGT-3’) were obtained from Qiagen. MAPK15-specific siRNA #2 (siMAPK15 #2 ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA isolation from Tbx4-CKO (n = 3) and Tbx4fl/fl (n = 3) lungs was performed using the RNeasy Mini Kit (Qiagen). The changes in gene expression were investigated by quantitative reverse transcription polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Immunology 2024Quote: ... 2 and 6 weeks post-SIV using the miRNeasy Mini Kit (QIAGEN). RNA was isolated from 1-2 x 106 PBMC resuspended in 700 µl QIAzol collected at week 7/Day -14 pre-ZIKV inoculation ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...